805 alleles found
RHeference identifier | Allele |
---|---|
RHef00652 | apparently deleted RHD with unexpected serology |
RHef00651 | apparently standard RHD with unexpected serology |
RHef00756 | ceCF - phenotypic description |
RHef00761 | ceSL - partly characterized or subtypes not seperated |
RHef00746 | D negative - phenotypic description |
RHef00670 | DAL (DV type 7) - phenotypic description |
RHef00627 | DBT - partly characterized or subtypes not separated |
RHef00579 | DBT - phenotypic description |
RHef00583 | DFR - phenotypic description |
RHef00724 | DHMi - phenotypic description |
RHef00661 | DHMii (obsolete) - phenotypic description |
RHef00584 | DI (obsolete) - phenotypic description |
RHef00580 | DII - phenotypic description |
RHef00753 | DIII - partly characterized or subtypes not seperated |
RHef00587 | DIII - phenotypic description |
RHef00588 | DIIIa - phenotypic description |
RHef00577 | DIIIb - phenotypic description |
RHef00589 | DIIIc - phenotypic description |
RHef00635 | DIV - partly characterized or subtypes not separated |
RHef00606 | DIV - phenotypic description |
RHef00762 | DIVa - partly characterized or subtypes not separated |
RHef00585 | DIVa - phenotypic description |
RHef00592 | DIVa(C-) haplotype - phenotypic description or partial characterization |
RHef00624 | DIVb - partly characterized or subtypes not separated |
RHef00586 | DIVb - phenotypic description |
RHef00671 | DNB - phenotypic description |
RHef00742 | DNU - phenotypic description |
RHef00618 | DOL - partly characterized or subtypes not separated |
RHef00594 | DOL - phenotypic description |
RHef00622 | DV - partly characterized or subtypes not separated |
RHef00593 | DV - phenotypic description |
RHef00654 | DV type 2 or DBS1 - subtypes not separated |
RHef00578 | DVa - phenotypic description |
RHef00747 | DVb - phenotypic description |
RHef00591 | DVc (obsolete) - phenotypic description |
RHef00620 | DVI - partly characterized or subtypes not separated |
RHef00581 | DVI - phenotypic description |
RHef00636 | DVII - partly characterized or subtypes not separated |
RHef00582 | DVII - phenotypic description |
RHef00630 | Hybrid RHD*D-CE-D allele - partly characterized |
RHef00598 | M1 |
RHef00599 | M2 |
RHef00600 | M3 |
RHef00601 | M4 |
RHef00744 | normal D positive - phenotypic description |
RHef00663 | Partial D - partly characterized |
RHef00745 | partial D - phenotypic description |
RHef00625 | R0Har - partly characterized |
RHef00590 | R0Har/DHAR - phenotypic description |
RHef00790 | RHCE*48C,462T,733G,1006T |
RHef00697 | RHCE*860C |
RHef00444 | RHCE*ce-D(6)-ce (RHD*01N.42) |
RHef00760 | RHCE*ce365T (ceSL.02) |
RHef00668 | RHCE*ce461C (ceRT, ce.11) |
RHef00749 | RHCE*ce48C,365T (ceSL.01 (48C,+/-105G,365T)) |
RHef00648 | RHCE*ce48C,697G,733G (ceCF, ce.20.06) |
RHef00751 | RHCE*ce508G (ceRG, RHCE*ce42) |
RHef00621 | RHCE*ce667T,697G,712G,733G,744C,787G,800A (ceHAR, ce.22) |
RHef00750 | RHCE*ce697G,712G,733G,744C (RHCE*ce37) |
RHef00755 | RHCE*ce733 - partly characterized or subtypes not seperated |
RHef00523 | RHCE*D(1)-CE |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00657 | RHD deletion - partly characterized |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00612 | RHD*-10C>T |
RHef00560 | RHD*-115C |
RHef00684 | RHD*1001A (W334*) |
RHef00342 | RHD*1006C (weak D type 58) |
RHef00164 | RHD*1007A (RHD*01N.80) |
RHef00186 | RHD*1010G (DEL38, RHD*01N.57) |
RHef00355 | RHD*1012G (weak D type 70) |
RHef00295 | RHD*1013C (weak D type 24) |
RHef00312 | RHD*1015A (weak D type 39) |
RHef00354 | RHD*1016A (weak D type 7) |
RHef00797 | RHD*1016C |
RHef00687 | RHD*1016T |
RHef00763 | RHD*1018A |
RHef00303 | RHD*1018_1019delinsAT (weak D type 30) |
RHef00148 | RHD*1019G |
RHef00232 | RHD*101G |
RHef00175 | RHD*1022A |
RHef00705 | RHD*1026insAC |
RHef00515 | RHD*1026T |
RHef00801 | RHD*1027delT |
RHef00482 | RHD*1029C>A (Y343*, RHD*01N.40) |
RHef00372 | RHD*1034A (weak D type 86) |
RHef00818 | RHD*1035A |
RHef00741 | RHD*1036T |
RHef00140 | RHD*1048C |
RHef00688 | RHD*1048T |
RHef00110 | RHD*1053T,1057_1061delinsTGGAA (DWN, RHD*49) |
RHef00819 | RHD*1054A |
RHef00404 | RHD*1056G |
RHef00085 | RHD*1057A (DNU, RHD*26) |
RHef00165 | RHD*1058T |
RHef00141 | RHD*105G,1195A |
RHef00136 | RHD*1060A (RHD*50) |
RHef00055 | RHD*1061A (DII) |
RHef00082 | RHD*1063A (DNB, RHD*25) |
RHef00121 | RHD*1065T |
RHef00706 | RHD*1066insA |
RHef00081 | RHD*1070A (DNAK, RHD*24) |
RHef00541 | RHD*1073+152A,1227A (IVS7+152A, DEL36) |
RHef00681 | RHD*1073+1A (IVS7+1A) |
RHef00507 | RHD*1073+1T (IVS7+1T, RHD*01N.70) |
RHef00736 | RHD*1073+2A (IVS7+2A) |
RHef00495 | RHD*1073+2C (IVS7+2C, RHD*01N.56) |
RHef00109 | RHD*1073C (DWI, RHD*33) |
RHef00508 | RHD*1074-1A (IVS7-1A, RHD*01N.71) |
RHef00512 | RHD*1074-2C (IVS7-2C, RHD*01N.26) |
RHef00502 | RHD*1084T (Q362*, RHD*01N.64) |
RHef00166 | RHD*1102A |
RHef00167 | RHD*1102T,1212A |
RHef00554 | RHD*1105A |
RHef00386 | RHD*1107C (weak D type 99) |
RHef00187 | RHD*1110T |
RHef00305 | RHD*1121A (weak D type 32) |
RHef00686 | RHD*1133C |
RHef00008 | RHD*1136T (DAU0) |
RHef00543 | RHD*113A (L38*, DEL39) |
RHef00438 | RHD*1141C |
RHef00379 | RHD*1145C (weak D type 92) |
RHef00242 | RHD*1145C,1177C (weak D type 10.1) |
RHef00343 | RHD*1148C (weak D type 59) |
RHef00719 | RHD*1151G |
RHef00299 | RHD*1152C (weak D type 28) |
RHef00469 | RHD*1153+1A (IVS8+1A, RHD*01N.26) |
RHef00616 | RHD*1153+6C (IVS8+6C) |
RHef00632 | RHD*1154-1C (IVS8-1C) |
RHef00542 | RHD*1154-31T (IVS8-31T, DEL37) |
RHef00531 | RHD*1154-8A (IVS8-8A, DEL20) |
RHef00168 | RHD*1154A (RHD*01N.53) |
RHef00288 | RHD*1154C (weak D type 2) |
RHef00798 | RHD*1154C,1163G |
RHef00406 | RHD*1154T |
RHef00707 | RHD*1166delA |
RHef00280 | RHD*1168G (weak D type 134) |
RHef00189 | RHD*1169C (weak D type 139) |
RHef00188 | RHD*1170C |
RHef00322 | RHD*1170C,1193T (weak D type 41.0.1) |
RHef00504 | RHD*1174delA (RHD*01N.66) |
RHef00176 | RHD*1175C |
RHef00820 | RHD*1175G |
RHef00241 | RHD*1177C (weak D type 10) |
RHef00243 | RHD*1177C,1199C (weak D type 10.2) |
RHef00510 | RHD*1179A (W393*, RHD*01N.76) |
RHef00552 | RHD*1181C |
RHef00368 | RHD*1184T (weak D type 82) |
RHef00378 | RHD*1187G (weak D type 91) |
RHef00174 | RHD*1190G (weak D type 156) |
RHef00321 | RHD*1193T (weak D type 41) |
RHef00360 | RHD*1194C (weak D type 75) |
RHef00326 | RHD*1195A (weak D type 45) |
RHef00367 | RHD*1199C (weak D type 81) |
RHef00271 | RHD*1199T (weak D type 126) |
RHef00143 | RHD*119G |
RHef00272 | RHD*1200T (weak D type 127) |
RHef00465 | RHD*1203A (Y401*, RHD*01N.22, DEL17) |
RHef00273 | RHD*1207T (weak D type 128) |
RHef00274 | RHD*1208T (weak D type 129) |
RHef00698 | RHD*1209delT |
RHef00037 | RHD*120A (DDE, RHD*27) |
RHef00142 | RHD*1210C (DEL29) |
RHef00357 | RHD*1212A (weak D type 72) |
RHef00767 | RHD*1213A |
RHef00821 | RHD*1213G |
RHef00498 | RHD*1213T (Q405*, RHD*01N.60) |
RHef00361 | RHD*1215C (weak D type 76) |
RHef00393 | RHD*1219_1224delTTCTGG (weak D type 60) |
RHef00454 | RHD*121T,643C,646C,988C (RHD*01N.09) |
RHef00329 | RHD*1221A (weak D type 46) |
RHef00231 | RHD*1222C (DEL10) |
RHef00293 | RHD*1224C (weak D type 22) |
RHef00323 | RHD*1226T (weak D type 42) |
RHef00691 | RHD*1227+5C (IVS9+5C) |
RHef00122 | RHD*1227A (DEL1) |
RHef00565 | RHD*1227A,149-29C (IVS1-29C) |
RHef00511 | RHD*1228-1A (IVS9-1A, RHD*01N.77) |
RHef00484 | RHD*1228-2del21 (F410fs*, RHD*01N.44) |
RHef00363 | RHD*1228G (weak D type 78) |
RHef00156 | RHD*1229C (weak D type 140) |
RHef00369 | RHD*1238G (weak D type 83) |
RHef00822 | RHD*1240C |
RHef00358 | RHD*1241T (weak D type 73) |
RHef00535 | RHD*1248_1249insG (DEL26) |
RHef00503 | RHD*124_125delAA (RHD*01N.65) |
RHef00291 | RHD*1250C (weak D type 20) |
RHef00675 | RHD*1250G |
RHef00714 | RHD*1252G (*418E) |
RHef00534 | RHD*1252T>A (*418K, DEL25) |
RHef00527 | RHD*1252_1253insT (*418L, DEL11) |
RHef00699 | RHD*1253C (*418S) |
RHef00633 | RHD*1269C |
RHef00392 | RHD*130delCTC (L44del, RHD*51) |
RHef00664 | RHD*1347G |
RHef00233 | RHD*143G |
RHef00209 | RHD*146G |
RHef00525 | RHD*147delA (DEL4) |
RHef00123 | RHD*147G |
RHef00526 | RHD*148+1A (IVS1+1A, DEL5) |
RHef00804 | RHD*148+1delG |
RHef00538 | RHD*148+1T (IVS1+1T, DEL31) |
RHef00722 | RHD*148+2delT (IVS1+2delT) |
RHef00692 | RHD*148+3T (IVS1+3T) |
RHef00532 | RHD*148+5C (IVS1+5C, DEL21) |
RHef00539 | RHD*149-29C (IVS1-29C, DEL32) |
RHef00229 | RHD*149A |
RHef00802 | RHD*14G |
RHef00010 | RHD*150C,1136T (DAU0.02) |
RHef00115 | RHD*150C,178C,201A,203A,307C (DIIIb Caucasian) |
RHef00514 | RHD*150C,178C,201A,203A,307C,702delG (RHD*01N.83) |
RHef00005 | RHD*150C,178C,201A,203A,602G,667G,957A,1025C (DAR6, DAR(ce2)) |
RHef00574 | RHD*150C,186T,410T,455C,543C,609A,654C,667G,674T,807G |
RHef00775 | RHD*156delA,241T |
RHef00248 | RHD*157T (weak D type 104) |
RHef00078 | RHD*161C (DMH, RHD*23) |
RHef00276 | RHD*163C (weak D type 130) |
RHef00125 | RHD*165T (DBO1) |
RHef00352 | RHD*165T,1213G (weak D type 68) |
RHef00521 | RHD*166A,270A (V56M,W90*) |
RHef00137 | RHD*173T (weak D type 143) |
RHef00395 | RHD*175A (weak D type 151) |
RHef00266 | RHD*176A (weak D type 121) |
RHef00415 | RHD*178C |
RHef00177 | RHD*178C,201A,203A,594T,667G,744T,941T,1025C |
RHef00300 | RHD*178C,201A,203A,594T,667G,744T,957A,1025C (weak D type 29) |
RHef00129 | RHD*178C,689T (RHD*60) |
RHef00178 | RHD*178G,307C,482C,640T,966C |
RHef00304 | RHD*17T (weak D type 31) |
RHef00780 | RHD*17T,1136T (DAU) |
RHef00374 | RHD*182C (weak D type 88) |
RHef00331 | RHD*182T (weak D type 48) |
RHef00001 | RHD*186T |
RHef00057 | RHD*186T,307C,410T,455C (DIII type 4.2) |
RHef00642 | RHD*186T,364A,873A |
RHef00056 | RHD*186T,410T,455C (DIII type 4) |
RHef00067 | RHD*186T,410T,455C,1048C (DIVa) |
RHef00072 | RHD*186T,410T,455C,509C,667G (D-SPM, RHD*40) |
RHef00058 | RHD*186T,410T,455C,602G,667G,819A (DIIIa) |
RHef00792 | RHD*186T,410T,455C,602G,733C(Ex9?) |
RHef00402 | RHD*186T,410T,455C,667G (DIII type 9) |
RHef00073 | RHD*186T,410T,455C,667G,1048C (DIVa-like) |
RHef00732 | RHD*186T,602G,667G,819A |
RHef00396 | RHD*187T (weak D type 152) |
RHef00696 | RHD*188A |
RHef00286 | RHD*19T (weak D type 18) |
RHef00196 | RHD*1G,1136T (DAU15) |
RHef00249 | RHD*200G (weak D type 105) |
RHef00765 | RHD*200T |
RHef00016 | RHD*201A,203A,1136T (DAU14) |
RHef00359 | RHD*203C (weak D type 74) |
RHef00267 | RHD*208T (weak D type 122) |
RHef00564 | RHD*208T,210_211insG |
RHef00328 | RHD*208T,818T,1195A (weak D type 45.2) |
RHef00371 | RHD*209A (weak D type 85) |
RHef00017 | RHD*209A,998A,1136T (DAU2) |
RHef00212 | RHD*213T |
RHef00419 | RHD*215_217delinsCAT |
RHef00485 | RHD*216_217dupCA,1195G>A (RHD*01N.45) |
RHef00250 | RHD*220G (weak D type 106) |
RHef00251 | RHD*223T (weak D type 107) |
RHef00548 | RHD*224A |
RHef00370 | RHD*227A (weak D type 84) |
RHef00730 | RHD*23T |
RHef00190 | RHD*242C (RHD*55) |
RHef00191 | RHD*251C (DEL6) |
RHef00277 | RHD*254G (weak D type 131) |
RHef00739 | RHD*254T |
RHef00013 | RHD*254T,835A,1136T (DAU11) |
RHef00439 | RHD*255A,1227A |
RHef00308 | RHD*260A (weak D type 35) |
RHef00549 | RHD*266C |
RHef00210 | RHD*266G |
RHef00805 | RHD*267C |
RHef00297 | RHD*26A (weak D type 26) |
RHef00572 | RHD*26G |
RHef00455 | RHD*270A (W90*, RHD*01N.10) |
RHef00748 | RHD*270C (W90C) |
RHef00192 | RHD*278G (DEL40) |
RHef00144 | RHD*284G |
RHef00169 | RHD*286A |
RHef00414 | RHD*286C |
RHef00252 | RHD*287A (weak D type 108) |
RHef00345 | RHD*28T (weak D type 61) |
RHef00803 | RHD*28T,916A |
RHef00479 | RHD*297_319delCCAGTTCCCTTCTGGGAAGGTGG (RHD*01N.37) |
RHef00344 | RHD*29A (weak D type 6) |
RHef00545 | RHD*29A,520A |
RHef00356 | RHD*29C (weak D type 71) |
RHef00211 | RHD*29T |
RHef00562 | RHD*29_42delGGCGCTGCCTGCCC |
RHef00195 | RHD*2C |
RHef00289 | RHD*301A,1154C (weak D type 2.1) |
RHef00213 | RHD*307C (RHD*39) |
RHef00108 | RHD*307C,329C (DVII type 2) |
RHef00785 | RHD*319T,712A |
RHef00723 | RHD*31T,602G,667G,819A |
RHef00456 | RHD*325delA (RHD*01N.11) |
RHef00721 | RHD*325G (RHD*66) |
RHef00555 | RHD*327_487-4163dup (weak D type 150) |
RHef00107 | RHD*329C (DVII) |
RHef00228 | RHD*329C,1054A |
RHef00546 | RHD*329C,667G |
RHef00477 | RHD*330_331delGT (RHD*01N.35) |
RHef00214 | RHD*334G |
RHef00467 | RHD*335+1A (IVS2+1A, RHD*01N.24) |
RHef00216 | RHD*335C (DEL42) |
RHef00215 | RHD*335T (01N.68) |
RHef00468 | RHD*336-1A (IVS2-1A, RHD*01N.25) |
RHef00533 | RHD*336-2delA (IVS2-2delA, DEL22, RHD*53) |
RHef00540 | RHD*336-2G (IVS2-2G, DEL33) |
RHef00704 | RHD*336-3T (IVS2-3T) |
RHef00710 | RHD*336-3T (IVS4+1A) |
RHef00806 | RHD*338C |
RHef00330 | RHD*340G (weak D type 47) |
RHef00285 | RHD*340T (weak D type 17) |
RHef00024 | RHD*340T,579A,1136T (DAU8) |
RHef00296 | RHD*341A (weak D type 25) |
RHef00433 | RHD*341A,1195A |
RHef00466 | RHD*343delC (RHD*01N.23) |
RHef00261 | RHD*346A (weak D type 117) |
RHef00260 | RHD*346C (weak D type 116) |
RHef00776 | RHD*346_354delGCCACCATG |
RHef00262 | RHD*347T (weak D type 118) |
RHef00558 | RHD*353A,520A |
RHef00027 | RHD*357C (DBO2) |
RHef00380 | RHD*359A (weak D type 93) |
RHef00807 | RHD*361A |
RHef00063 | RHD*361A,380C,383G,455C (DIIIc) |
RHef00483 | RHD*361_371delTTGTCGGTGCT or RHD*356_366delGTGCTTTGTCG (RHD*01N.41) |
RHef00234 | RHD*364A,602G,667G,744T,1025C (weak D type 4.2.3(S122T)) |
RHef00217 | RHD*365G (weak D type 153) |
RHef00338 | RHD*365T (weak D type 54) |
RHef00373 | RHD*374A (weak D type 87) |
RHef00253 | RHD*376C (weak D type 109) |
RHef00268 | RHD*379T (weak D type 123) |
RHef00126 | RHD*384C |
RHef00278 | RHD*394A (weak D type 132) |
RHef00157 | RHD*394C (weak D type 132.0.1) |
RHef00279 | RHD*395A (weak D type 133) |
RHef00685 | RHD*396_397insGG |
RHef00179 | RHD*399C |
RHef00310 | RHD*399T (weak D type 37) |
RHef00194 | RHD*3A (DEL2) |
RHef00198 | RHD*403G |
RHef00132 | RHD*410A (DEL7) |
RHef00061 | RHD*410T,455C (DIII type 8) |
RHef00401 | RHD*410T,455C,509C,667G (DOL4, RHD*12.04) |
RHef00059 | RHD*410T,455C,602G,667G,819A (DIII type 6) |
RHef00088 | RHD*410T,509C,667G (DOL3, RHD*12.03) |
RHef00631 | RHD*413C |
RHef00254 | RHD*413G (weak D type 110) |
RHef00441 | RHD*41G (weak D type 145) |
RHef00202 | RHD*41T (weak D type 136) |
RHef00794 | RHD*421_422delinsA |
RHef00390 | RHD*424delATG (M142del, RHD*01N.74) |
RHef00808 | RHD*426A,885T |
RHef00674 | RHD*431C |
RHef00146 | RHD*436A (weak D type 147) |
RHef00145 | RHD*438C (weak D type 146) |
RHef00420 | RHD*439A,1195A |
RHef00219 | RHD*443G (RHD*01N.73) |
RHef00405 | RHD*443G,584T |
RHef00333 | RHD*446A (weak D type 5) |
RHef00457 | RHD*449delT (L150*, RHD*01N.12) |
RHef00557 | RHD*452A |
RHef00084 | RHD*455C (DNT, RHD*38) |
RHef00825 | RHD*455C,667G,697C,1136T (DAU) |
RHef00199 | RHD*455C,809G (DNT(V270G), RHD*62) |
RHef00731 | RHD*455C,968A |
RHef00181 | RHD*458C (DEL12) |
RHef00429 | RHD*463G |
RHef00230 | RHD*46C (DEL43) |
RHef00733 | RHD*470G |
RHef00727 | RHD*479G |
RHef00149 | RHD*482G |
RHef00083 | RHD*485G (DNS, RHD*48) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00774 | RHD*486+1A,1195A (IVS3+1A) |
RHef00519 | RHD*486+2A (IVS3+2A, DEL9) |
RHef00575 | RHD*486+3C (IVS3+3C) |
RHef00649 | RHD*486+5A (IVS3+5A) |
RHef00735 | RHD*487-1A (IVS-1A) |
RHef00703 | RHD*487-3A (IVS3-3A) |
RHef00458 | RHD*487_490delACAG or RHD*489_492delAGAC (RHD*01N.13) |
RHef00453 | RHD*48A (W16*, RHD*01N.08) |
RHef00092 | RHD*48C (DUC3) |
RHef00015 | RHD*48C,1136T (DAU13) |
RHef00679 | RHD*48C,520A,1193T |
RHef00315 | RHD*48C,602G,667G,819A (weak D type 4.1, DAR4) |
RHef00770 | RHD*48C,697A,1136T (DAU) |
RHef00038 | RHD*490A (DDN, RHD*43) |
RHef00139 | RHD*492A (RHD*61) |
RHef00235 | RHD*492G |
RHef00040 | RHD*494G (DFL, RHD*28) |
RHef00170 | RHD*496G |
RHef00048 | RHD*497C (DFW, RHD*18) |
RHef00695 | RHD*497G (DFW2) |
RHef00789 | RHD*4_5delinsTC,6_7insG |
RHef00044 | RHD*505C,509G (DFR4, RHD*17.04) |
RHef00041 | RHD*505C,509G,514T (DFR1, RHD*17.01) |
RHef00043 | RHD*505C,509G,514T,539C (DFR3, RHD*17.03) |
RHef00781 | RHD*509C |
RHef00086 | RHD*509C,667G (DOL1, RHD*12.01) |
RHef00087 | RHD*509C,667G,1132G (DOL2, RHD*12.02) |
RHef00079 | RHD*510A (DMI, RHD*47) |
RHef00666 | RHD*510insG |
RHef00080 | RHD*510T (DMI-1.1, RHD*47.01) |
RHef00171 | RHD*511G |
RHef00053 | RHD*513A (DHQ, RHD*44) |
RHef00796 | RHD*519G |
RHef00127 | RHD*519T |
RHef00306 | RHD*520A (weak D type 33) |
RHef00478 | RHD*520A,1080_1089delCTTCCAGGTC (RHD*01N.36) |
RHef00224 | RHD*520A,916A |
RHef00809 | RHD*520A,916A,932G |
RHef00436 | RHD*520A,919A |
RHef00236 | RHD*525T (RHD*59) |
RHef00559 | RHD*526A |
RHef00720 | RHD*526C |
RHef00239 | RHD*52G,809G (weak D type 1.1) |
RHef00025 | RHD*535C,1136T (DAU9) |
RHef00151 | RHD*536C |
RHef00150 | RHD*537G |
RHef00158 | RHD*538A |
RHef00366 | RHD*539A (weak D type 80) |
RHef00810 | RHD*539_540delinsTT |
RHef00182 | RHD*53C (DEL3) |
RHef00680 | RHD*53delT |
RHef00641 | RHD*541T |
RHef00384 | RHD*542C (weak D type 97) |
RHef00014 | RHD*542C,1136T (DAU12) |
RHef00282 | RHD*544A,594T,602G (weak D type 14) |
RHef00486 | RHD*545_548delCTGT (RHD*01N.46) |
RHef00459 | RHD*554A (W185*, RHD*01N.14) |
RHef00522 | RHD*555A (W185*) |
RHef00364 | RHD*560C (weak D type 79) |
RHef00411 | RHD*567T,770T |
RHef00128 | RHD*576T |
RHef00009 | RHD*579A,1136T (DAU0.01) |
RHef00012 | RHD*579A,739A,1136T (DAU10) |
RHef00147 | RHD*579C (weak D type 144) |
RHef00509 | RHD*581_582insG (RHD*01N.75) |
RHef00269 | RHD*594T (weak D type 124) |
RHef00335 | RHD*594T,602G (weak D type 51) |
RHef00180 | RHD*594T,602G,667G,819A (weak D type 4.4) |
RHef00497 | RHD*598T (Q200*, RHD*01N.59) |
RHef00547 | RHD*59A |
RHef00425 | RHD*59C |
RHef00619 | RHD*600delG |
RHef00320 | RHD*602G (weak D type 40) |
RHef00006 | RHD*602G,607G,667G,744T,957A,1025C (DAR(T203A)) |
RHef00314 | RHD*602G,667G (weak D type 4.0.1, DAR3) |
RHef00003 | RHD*602G,667G,1025C (weak D type 4.2.0, DAR1.00) |
RHef00788 | RHD*602G,667G,1025C,1063A |
RHef00771 | RHD*602G,667G,697C,733C,1136T (DAU) |
RHef00237 | RHD*602G,667G,697C,733C,744T,1136T (DAU) |
RHef00007 | RHD*602G,667G,697C,744T,957A,1025C (DAR2.01) |
RHef00004 | RHD*602G,667G,697C,957A,1025C (DAR2.00) |
RHef00318 | RHD*602G,667G,744T,1025C (weak D type 4.2.3, DAR1.03) |
RHef00317 | RHD*602G,667G,744T,957A,1025C (weak D type 4.2.2, DAR1.02) |
RHef00138 | RHD*602G,667G,744T,957A,1025C,1063A |
RHef00423 | RHD*602G,667G,792T,819A |
RHef00313 | RHD*602G,667G,819A (weak D type 4.0, DAR3.01) |
RHef00221 | RHD*602G,667G,819A,1063A (weak D type 4.5) |
RHef00824 | RHD*602G,667G,819A,1170C,1193T (DAR3.1−CE(9)−D) |
RHef00319 | RHD*602G,667G,819A,872G (weak D type 4.3, DAR5) |
RHef00220 | RHD*602G,667G,819A,919A |
RHef00316 | RHD*602G,667G,957A,1025C (weak D type 4.2.1, DAR1.01) |
RHef00435 | RHD*602G,809G |
RHef00766 | RHD*604A |
RHef00676 | RHD*605A,1136T (DAU) |
RHef00324 | RHD*605T (weak D type 43) |
RHef00520 | RHD*609A,654C,667G,674T,807G |
RHef00287 | RHD*611C (weak D type 19) |
RHef00476 | RHD*615_616delCA (RHD*01N.34) |
RHef00077 | RHD*621C (DMA, RHD*35) |
RHef00133 | RHD*626T |
RHef00677 | RHD*626T,1136T,1170C,1193T (RHD*DAU[626T]-CE(9)-D) |
RHef00245 | RHD*62C (weak D type 101) |
RHef00563 | RHD*634+1T (IVS4+1T) |
RHef00506 | RHD*634+1T,1136T (DAU, RHD*01N.69) |
RHef00711 | RHD*634+2A (IVS4+2A) |
RHef00529 | RHD*634+5A (IVS4+5A) |
RHef00528 | RHD*634+5T (IVS4+5T, DEL14) |
RHef00255 | RHD*634A (weak D type 111) |
RHef00159 | RHD*634C (DEL16) |
RHef00294 | RHD*634T (weak D type 23) |
RHef00443 | RHD*635-2C (IVS4-2C, RHD*54) |
RHef00530 | RHD*635-2G (IVS4-2G, DEL19) |
RHef00256 | RHD*635A (weak D type 112) |
RHef00160 | RHD*635T (RHD*01N.15) |
RHef00090 | RHD*636T (DUC1) |
RHef00341 | RHD*640T (weak partial D type 57) |
RHef00729 | RHD*643delTTC or RHD*644delTCT or RHD*645delCTT (215delF) |
RHef00183 | RHD*648C (weak D type 154) |
RHef00461 | RHD*652delA,653G (RHD*01N.17) |
RHef00740 | RHD*654C |
RHef00284 | RHD*658C (weak D type 16) |
RHef00340 | RHD*65A (weak D type 56) |
RHef00472 | RHD*660delG or RHD*659delG (RHD*01N.29, RHD*01N.78) |
RHef00346 | RHD*661A (weak D type 62) |
RHef00298 | RHD*661T (weak D type 27) |
RHef00203 | RHD*662G |
RHef00550 | RHD*662T |
RHef00046 | RHD*667G (DFV, RHD*08.01) |
RHef00644 | RHD*667G,1136T (DAU) |
RHef00089 | RHD*667G,674T (DTO, RHD*30) |
RHef00035 | RHD*667G,676C (DCS1, RHD*16.01) |
RHef00093 | RHD*667G,697C (DV type 1, Kou) |
RHef00021 | RHD*667G,697C,1122T,1136T (DAU5.01) |
RHef00020 | RHD*667G,697C,1136T (DAU5) |
RHef00662 | RHD*667G,697C,1136T,1177C (DAU) |
RHef00768 | RHD*667G,697C,733C,744T |
RHef00154 | RHD*667G,800T |
RHef00811 | RHD*667G,809G |
RHef00047 | RHD*667G,819A (DFV.1) |
RHef00153 | RHD*667G,833T |
RHef00152 | RHD*668C (weak D type 141, RHD*52) |
RHef00200 | RHD*670G (weak D type 148) |
RHef00787 | RHD*671C |
RHef00270 | RHD*671G (weak D type 125) |
RHef00701 | RHD*673C |
RHef00002 | RHD*674T (DSF) |
RHef00036 | RHD*676C (DCS2, RHD*16.02) |
RHef00034 | RHD*677A (DCC, RHD*42) |
RHef00737 | RHD*679delCT |
RHef00375 | RHD*67C (weak D type 89) |
RHef00135 | RHD*67T (weak D type 142) |
RHef00026 | RHD*680C (DBA, RHD*56) |
RHef00184 | RHD*683A |
RHef00553 | RHD*683C |
RHef00709 | RHD*683del16 |
RHef00388 | RHD*684_686delGAG (DVL1, RHD*31) |
RHef00054 | RHD*686A (DHR, RHD*22) |
RHef00694 | RHD*688C |
RHef00218 | RHD*689A |
RHef00418 | RHD*689T |
RHef00011 | RHD*689T,1136T (DAU1) |
RHef00349 | RHD*68A (weak D type 65) |
RHef00204 | RHD*691_692delinsTT |
RHef00050 | RHD*697A (DV type 5, DHK) |
RHef00019 | RHD*697A,1136T (DAU4) |
RHef00097 | RHD*697C (DV type 4, SM) |
RHef00513 | RHD*697delG (RHD*01N.82) |
RHef00111 | RHD*700T (DYU, RHD*29) |
RHef00052 | RHD*704C (DHO, RHD*20) |
RHef00427 | RHD*705T |
RHef00389 | RHD*705_707delGAA (DVL2, RHD*32) |
RHef00134 | RHD*710A |
RHef00397 | RHD*710T (weak D type 155) |
RHef00460 | RHD*711delC (RHD*01N.16) |
RHef00702 | RHD*712A,1048C |
RHef00240 | RHD*712A,809G (weak D type 1.2) |
RHef00225 | RHD*712C,809G |
RHef00475 | RHD*712delG (RHD*01N.33) |
RHef00738 | RHD*717A |
RHef00201 | RHD*718C |
RHef00222 | RHD*721C (DEL45) |
RHef00351 | RHD*722T (weak D type 67) |
RHef00728 | RHD*724G |
RHef00334 | RHD*727A (weak D type 50) |
RHef00325 | RHD*728G (weak D type 44) |
RHef00614 | RHD*729A (Y243*) |
RHef00382 | RHD*730C (weak D type 95) |
RHef00383 | RHD*731T (weak D type 96) |
RHef00091 | RHD*733C (DUC2, RHD*37) |
RHef00437 | RHD*733C,744T,787A,800T |
RHef00410 | RHD*739C |
RHef00246 | RHD*73T (weak D type 102) |
RHef00337 | RHD*740G (weak D type 53) |
RHef00812 | RHD*744A |
RHef00678 | RHD*744T,1136T (DAU) |
RHef00717 | RHD*745_746delinsAG |
RHef00473 | RHD*745_757delGTGGTGACAGCCA (RHD*01N.30) |
RHef00487 | RHD*745_759delinsAG (RHD*01N.47) |
RHef00385 | RHD*751C (weak D type 98) |
RHef00347 | RHD*758A (weak D type 63) |
RHef00394 | RHD*75dupTCT (L26dup) |
RHef00500 | RHD*761G (S254*, RHD*01N.62) |
RHef00434 | RHD*761T,1136T |
RHef00161 | RHD*763A |
RHef00764 | RHD*763C |
RHef00682 | RHD*764A |
RHef00362 | RHD*766C (weak D type 77) |
RHef00481 | RHD*767G (S256*, RHD*01N.39) |
RHef00332 | RHD*770T (weak D type 49) |
RHef00428 | RHD*773C |
RHef00173 | RHD*779G (weak D type 149) |
RHef00172 | RHD*780A (weak D type 137) |
RHef00403 | RHD*781G |
RHef00693 | RHD*782T |
RHef00795 | RHD*784delC |
RHef00517 | RHD*786delA (DEL13) |
RHef00244 | RHD*787A (weak D type 100) |
RHef00407 | RHD*787A,1195A |
RHef00432 | RHD*787_788delinsTT,1136T (DAU) |
RHef00474 | RHD*78delC (RHD*01N.32) |
RHef00408 | RHD*796G,809G |
RHef00391 | RHD*79delCTC (L27del) |
RHef00416 | RHD*800T |
RHef00493 | RHD*801+1A (IVS5+1A, RHD*01N.54) |
RHef00778 | RHD*801+1T (IVS5+1G>T) |
RHef00712 | RHD*801+2A (IVS5+2A) |
RHef00193 | RHD*802-38delTCTC (IVS5-41delCTCT, DEL35) |
RHef00496 | RHD*802-41_802-38delCTCT,1157A (L386*, RHD*01N.58) |
RHef00462 | RHD*807G (Y269*, RHD*01N.18 ) |
RHef00307 | RHD*809A (weak D type 34) |
RHef00777 | RHD*809C |
RHef00238 | RHD*809G (weak D type 1) |
RHef00265 | RHD*818A (weak D type 120) |
RHef00263 | RHD*818T (weak D type 119) |
RHef00327 | RHD*818T,1195A (weak D type 45.1) |
RHef00488 | RHD*822delG (RHD*01N.48) |
RHef00275 | RHD*826C (weak D type 13) |
RHef00793 | RHD*829A |
RHef00264 | RHD*830A (weak D type 12) |
RHef00311 | RHD*833A (weak D type 38) |
RHef00018 | RHD*835A,1136T (DAU3) |
RHef00023 | RHD*835A,998A,1136T (DAU7) |
RHef00039 | RHD*838A (DEL24) |
RHef00226 | RHD*841C |
RHef00813 | RHD*842C |
RHef00309 | RHD*842G (weak D type 36) |
RHef00430 | RHD*843T |
RHef00283 | RHD*845A (weak partial D type 15) |
RHef00623 | RHD*845A,1227A |
RHef00051 | RHD*848T (DHMi, RHD*19) |
RHef00734 | RHD*851G |
RHef00075 | RHD*851T (DLO, RHD*36) |
RHef00064 | RHD*854A (DIM, RHD*34) |
RHef00784 | RHD*856G |
RHef00725 | RHD*861C |
RHef00066 | RHD*862T (DIT2) |
RHef00065 | RHD*863C (DIT1) |
RHef00206 | RHD*871T (weak D type 138) |
RHef00205 | RHD*872G (DEL41) |
RHef00257 | RHD*874C (weak D type 113) |
RHef00376 | RHD*880C (weak D type 9) |
RHef00348 | RHD*881T (weak D type 64) |
RHef00700 | RHD*883G |
RHef00281 | RHD*884A (weak D type 135) |
RHef00381 | RHD*884C (weak D type 94, DEL46) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00417 | RHD*890C |
RHef00339 | RHD*895G (weak D type 55) |
RHef00185 | RHD*896C (RHD*01N.79) |
RHef00301 | RHD*8G (weak D type 3) |
RHef00302 | RHD*8G,178C (weak D type 3.1) |
RHef00799 | RHD*8G,49delG |
RHef00786 | RHD*901A |
RHef00470 | RHD*908_909insTGGCT,939+2_939+5delTAAG (RHD*01N.27) |
RHef00814 | RHD*914T |
RHef00489 | RHD*915delC (RHD*01N.49) |
RHef00350 | RHD*916A (weak D type 66) |
RHef00440 | RHD*916A,932G |
RHef00290 | RHD*916A,932G,1154C (weak D type 2.2) |
RHef00365 | RHD*919A (weak D type 8) |
RHef00162 | RHD*919C |
RHef00247 | RHD*91A (weak D type 103) |
RHef00551 | RHD*920A |
RHef00426 | RHD*922A |
RHef00492 | RHD*922T (G308*, RHD*01N.52, DEL15) |
RHef00336 | RHD*92C (weak D type 52) |
RHef00131 | RHD*932G |
RHef00463 | RHD*933A (Y311*, RHD*01N.19) |
RHef00501 | RHD*933G (Y311*, RHD*01N.63) |
RHef00208 | RHD*937A |
RHef00292 | RHD*938T (weak partial D type 21) |
RHef00494 | RHD*939+1A (IVS6+1A, RHD*01N.55) |
RHef00480 | RHD*939+2A (IVS6+2A, RHD*01N.38) |
RHef00566 | RHD*939+3C (IVS6+3C) |
RHef00207 | RHD*939A |
RHef00431 | RHD*939C |
RHef00815 | RHD*939T,1136T (DAU) |
RHef00155 | RHD*93A |
RHef00708 | RHD*93delC (RHD*01N.31) |
RHef00490 | RHD*93insT (RHD*01N.50, DEL18) |
RHef00576 | RHD*940-14delTAA (IVS6-14delTAA) |
RHef00769 | RHD*940-3T (IVS6-3T) |
RHef00615 | RHD*940-4C (IVS6-4C) |
RHef00163 | RHD*941T (RHD*01N.20) |
RHef00716 | RHD*948A (C316*) |
RHef00690 | RHD*94insA or RHD*94dupA |
RHef00491 | RHD*950delA (RHD*01N.51) |
RHef00499 | RHD*952T (R318*, RHD*01N.61) |
RHef00353 | RHD*953A (weak D type 69) |
RHef00227 | RHD*956G |
RHef00223 | RHD*95A |
RHef00387 | RHD*960A |
RHef00640 | RHD*963A |
RHef00028 | RHD*968A (DBO3) |
RHef00258 | RHD*968T (weak D type 114) |
RHef00471 | RHD*970_972delCAC,976_991delTCCATCATGGGCTACA (RHD*01N.28) |
RHef00816 | RHD*973T |
RHef00259 | RHD*983A (weak D type 115) |
RHef00573 | RHD*985_986delinsCA,989C,992T |
RHef00464 | RHD*990G (Y330*, RHD*01N.21) |
RHef00536 | RHD*993delC (DEL28) |
RHef00377 | RHD*993G (weak D type 90) |
RHef00022 | RHD*998A,1136T (DAU6) |
RHef00561 | RHD*CE(1-2)-D[361del11] |
RHef00112 | RHD*CE(1-3)-D (RHD*01N.43) |
RHef00647 | RHD*CE(1-8)-D(9-10) |
RHef00445 | RHD*CE(1-9)-D (RHD*01N.02) |
RHef00667 | RHD*ce48C(1-2)-DIIIa(3)-ceS(4-7)-D |
RHef00828 | RHD*D psi,819A |
RHef00757 | RHD*D(1-6)-Ex7?-D(8-10) - partly characterized |
RHef00659 | RHD*D(1-9)-?Ex10? - partly characterized |
RHef00409 | RHD*D(329C)-ce(3-9)-D |
RHef00413 | RHD*D(410T,455C)-CE(4-6)-D |
RHef00399 | RHD*D(602G)-CE(5)-D(1025C) |
RHef00400 | RHD*D(640T)-CE(7)-D |
RHef00617 | RHD*D-CE(10) |
RHef00124 | RHD*D-CE(2)-D(1063A) |
RHef00060 | RHD*D-ce(2)-DIIIa (DIII type 7) |
RHef00074 | RHD*D-CE(2-3)-D (DKK, RHD*45) |
RHef00114 | RHD*D-CE(2-5)-D |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00791 | RHD*D-CE(2-7/8?)-D partly characterized |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00116 | RHD*D-CE(3)-weak D type 4.0 (RHD*01N.72) |
RHef00544 | RHD*D-CE(3-10) |
RHef00045 | RHD*D-CE(3-4)-D (DFR5, RHD*17.05) |
RHef00106 | RHD*D-CE(3-5)-D (DVI type 4) |
RHef00104 | RHD*D-CE(3-6)-D (DVI type 3) |
RHef00569 | RHD*D-cE(3-7)-D(weak D Type 2) |
RHef00759 | RHD*D-CE(3-8/9)-D - partly characterized |
RHef00042 | RHD*D-CE(4)-D (DFR2, RHD*17.02) |
RHef00102 | RHD*D-cE(4-5)-D (DVI type 1) |
RHef00103 | RHD*D-CE(4-6)-D (DVI type 2) |
RHef00611 | RHD*D-cE(4-7)-D |
RHef00117 | RHD*D-CE(4-7)-D (RHD*01N.07) |
RHef00118 | RHD*D-CE(4-9)-D (DEL44) |
RHef00412 | RHD*D-CE(5)(733G)-D |
RHef00029 | RHD*D-cE(5)-D (DBS1, DTI, RHD*13.01) |
RHef00095 | RHD*D-CE(5)-D (DV type 2, Hus) |
RHef00113 | RHD*D-cE(5-6)-D |
RHef00094 | RHD*D-CE(5-6)-D (DV type 10) |
RHef00076 | RHD*D-CE(5-6)[697G]-D (DLX, RHD*46) |
RHef00031 | RHD*D-Ce(5-7)-D (D-Ce(5-8)-D, DBT-1, RHD*14.01) |
RHef00033 | RHD*D-cE(5-7)-D (DBU, RHD*41, DEL23) |
RHef00032 | RHD*D-Ce(5-9)-D (DBT2, RHD*14.02) |
RHef00030 | RHD*D-cE(5:667-5:697)-D (DBS2, RHD*13.02, RHD*16.03) |
RHef00098 | RHD*D-CE(5:667-5:712)-D (DV type 6) |
RHef00683 | RHD*D-cE(5:667-5:744)-D |
RHef00100 | RHD*D-CE(5:667-5:744)-D (DV type 8) |
RHef00099 | RHD*D-CE(5:667-5:787)-D (DV type 7, DAL) |
RHef00096 | RHD*D-CE(5:667-5:800)-D (DV type 3, DBS0) |
RHef00424 | RHD*D-cE(5:676-5:733)-D |
RHef00101 | RHD*D-CE(5:697-5:712)-D (DV type 9, TO) |
RHef00398 | RHD*D-CE(5:697-5:744)-D |
RHef00422 | RHD*D-ce(5:733-5:787)-D |
RHef00069 | RHD*D-CE(6-9)-D (DIV type 3) |
RHef00119 | RHD*D-CE(7)-D (RHD*58) |
RHef00752 | RHD*D-CE(7-10) |
RHef00071 | RHD*D-CE(7-9)-D (DIV type 5) |
RHef00070 | RHD*D-CE(7:1048-7:1061)-D (DIV type 4) |
RHef00068 | RHD*D-CE(7:1048-9:1193)-D (DIVb) |
RHef00120 | RHD*D-CE(8-9)-D |
RHef00421 | RHD*D-ceAG(2)-D |
RHef00639 | RHD*D-ceEK(2-7)-D |
RHef00689 | RHD*D-CEVS(3-9)-D |
RHef00451 | RHD*D-CEVS(4-7)-D (RHD*01N.06) |
RHef00758 | RHD*D-Ex2?-D(3-10) - partly characterized |
RHef00823 | RHD*DAR1.2−CE(9)−D |
RHef00634 | RHD*DAU - partly characterized or subtypes not separated |
RHef00596 | RHD*DCS - partly characterized or subtypes not separated |
RHef00665 | RHD*del82_84TTC (DMW) |
RHef00604 | RHD*DFR - partly characterized or subtypes not separated |
RHef00718 | RHD*DIII-CE(9)-D(604A) |
RHef00062 | RHD*DIIIa(150C) |
RHef00643 | RHD*DIIIa(384C) |
RHef00672 | RHD*DIIIa(819G) |
RHef00772 | RHD*DIIIa-CE(4-9)-D |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00827 | RHD*DIIIa−CE(9)−D |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00779 | RHD*Dpsi,1074-214_1074-213insACAG |
RHef00715 | RHD*Dpsi-CE(6)-D |
RHef00568 | RHD*Dpsi-OT1 |
RHef00449 | RHD*D[203G>C]-Ce(3-9)-D |
RHef00782 | RHD*D[667G,697C]-CE(6-9)-D |
RHef00783 | RHD*D[667G,697C]-CE(7-9)-D |
RHef00800 | RHD*Ex1-3del |
RHef00773 | RHD*Ex1-5del |
RHef00567 | RHD*Ex10del type 1 |
RHef00524 | RHD*Ex10del type 2 |
RHef00505 | RHD*Ex1del (RHD*01N.67) |
RHef00650 | RHD*Ex2del |
RHef00570 | RHD*Ex3del,602G,667G,819A |
RHef00537 | RHD*Ex8del (DEL30) |
RHef00571 | RHD*Ex9del |
RHef00105 | RHD*RHD*D-CE(3-6)-D(1195A) (RHD*DVI type 3.2) |
RHef00660 | RHDex10del - partly characterized |
RHef00754 | RN haplotype (with molecular analysis) |
RHef00595 | RN haplotype - phenotypic description or partial characterization |
RHef00442 | standard RHD (RHD*01) |
RHef00658 | standard RHD - partly characterized |
RHef00629 | weak D - partly characterized or subtypes not detailed |
RHef00743 | weak D or Du phenotype |
RHef00603 | weak D type 1 - partly characterized or subtypes not separated |
RHef00626 | weak D type 4 - partly characterized or subtypes not separated |
RHef00602 | weak D type 4.2.x (DAR) - partly characterized or subtypes not separated |
RHef00628 | weak D type 45 - partly characterized or subtypes not separated |