RHD*Ex1-5del
(ISBT table: not listed)
This entry is an RHD allele.
RHD*(6-10), RHD*Ex(1-5)del, RHD*Ex1-5del,
Molecular data
Nucleotides:
exon deletion(s);
Amino acids: exon deletion(s) [1, 2, 3, 4, 5];
Hybrid allele encompassing at least one RHCE exon:
del(Ex1-Ex5)-RHD(6-10)
Comments on the molecular basis:
- NGS
- Breakpoints were detected by long-range PCR. Indel c.1−6148_802−602delinsTAACAATAACTTAACAATAA CTTAACAATGTTAAGTCACTT spans approximately 36.4 Kb.
Extracellular position of one or more amino acid substitutions:
Splicing:
Unconventional prediction methods:
Phenotype
Main D phenotype: D negative (DEL not excluded) (last update: Jan. 7, 2021)Reports by D phenotype
Other RH phenotypes: RH:-3,
- RH:-3 inferred from the reported RHCE phenotypes of the carriers
Serology with monoclonal anti-D
Antigen Density (Ag/RBC)
More phenotype data
Rhesus Similarity Index
Haplotype
Main CcEe phenotype association: Ce? (last update: Jan. 8, 2021)Alloimmunization
Antibodies in carriers
Antibody specificity: D (RH1)
Summary: D negative, at risk for anti-D (last update: Jan. 6, 2021)Detailed information
Antibodies in D negative recipients
Alloimmunization in recipients: not expected, see phenotype data
Reports
Summary: exceptional description(s), in the Italian population (last update: Jan. 6, 2021)Detailed reports
- 2/310 donors with D negative phenotype, C and/or E positive Caucasian, in the Italian population
- 1 hemizygote among 278 samples selected for the development of nonspecific quantitative next-generation sequencing. (non-random samples, may have been reported in other studies)
Allele or phenotype frequency
Structure mapping
| Movement | Mouse Input | Touch Input | ||
|---|---|---|---|---|
| Rotation | Primary Mouse Button | Single touch | ||
| Translation | Middle Mouse Button or Ctrl+Primary | Triple touch | ||
| Zoom | Scroll Wheel or Second Mouse Button or Shift+Primary | Pinch (double touch) | ||
| Slab | Ctrl+Second | Not Available |
References
- Izaskun Apraiz et al. Performance Evaluation Study of ID RHD XT as a Molecular Tool for RHD Gene Screening in Pooled Blood Samples of Serologically D− C/E+ Donors Transfusion, 2019. — Abstract — [RHeference]
- Floch A et al. Comment from Rheference Online ressource, 2020. — Online ressource — [RHeference]
- Stef M et al. RH genotyping by nonspecific quantitative next-generation sequencing. Transfusion, 2020. [Citation] [RHeference]
- Matteocci A et al. Two new RHD alleles with deletions spanning multiple exons. Transfusion, 2021. [Citation] [RHeference]
Last update: Jan. 8, 2021