Online ressource
This reference was identified in a congress abstract or in an online resource.
Comment from Rheference. Floch A, Téletchéa S, Tournamille C, de Brevern AG, Pirenne F. Online ressource, 2020.
Remark: vol. since 2020
Annotations by Allele
- DBT - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DBT - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DBT - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DII - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DIIIa - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DIIIa - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DIIIb - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DIIIb - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DIVa - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DVa - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DVI - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DVI - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DVI - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DVII - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- DVII - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- R0Har/DHAR - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- R0Har/DHAR - phenotypic description: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHCE*ce365T (ceSL.02): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHCE*ce365T (ceSL.02): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHCE*ce461C (ceRT, ce.11): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHCE*ce461C (ceRT, ce.11): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHCE*ce48C,365T (ceSL.01 (48C,+/-105G,365T)): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHCE*ce48C,365T (ceSL.01 (48C,+/-105G,365T)): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHCE*ce667T,697G,712G,733G,744C,787G,800A (ceHAR, ce.22): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHCE*ce667T,697G,712G,733G,744C,787G,800A (ceHAR, ce.22): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHCE*D(1)-CE: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHCE*D(1)-CE: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD deletion (RHD*01N.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD deletion (RHD*01N.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD deletion (RHD*01N.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD deletion (RHD*01N.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*-10C>T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*-115C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1006C (weak D type 58): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1007A (RHD*01N.80): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1007A (RHD*01N.80): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1010G (DEL38, RHD*01N.57): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1012G (weak D type 70): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1013C (weak D type 24): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1013C (weak D type 24): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1015A (weak D type 39): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1016C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*101G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*101G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1027delT: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1029C>A (Y343*, RHD*01N.40): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1034A (weak D type 86): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1053T,1057_1061delinsTGGAA (DWN, RHD*49): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1053T,1057_1061delinsTGGAA (DWN, RHD*49): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1058T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*105G,1195A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1060A (RHD*50): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1063A (DNB, RHD*25): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1063A (DNB, RHD*25): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1065T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1070A (DNAK, RHD*24): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1073+1A (IVS7+1A): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1073+1T (IVS7+1T, RHD*01N.70): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1073+2A (IVS7+2A): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1073+2C (IVS7+2C, RHD*01N.56): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1073C (DWI, RHD*33): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1074-1A (IVS7-1A, RHD*01N.71): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1074-2C (IVS7-2C, RHD*01N.26): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1084T (Q362*, RHD*01N.64): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1105A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1107C (weak D type 99): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1110T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1121A (weak D type 32): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1121A (weak D type 32): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1136T (DAU0): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1136T (DAU0): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1145C (weak D type 92): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1145C,1177C (weak D type 10.1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1148C (weak D type 59): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1151G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1151G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1153+1A (IVS8+1A, RHD*01N.26): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1153+1A (IVS8+1A, RHD*01N.26): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1153+1A (IVS8+1A, RHD*01N.26): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1153+6C (IVS8+6C): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1154-31T (IVS8-31T, DEL37): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1154-31T (IVS8-31T, DEL37): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1154A (RHD*01N.53): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1154C (weak D type 2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1154C (weak D type 2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1154C (weak D type 2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1154C,1163G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1168G (weak D type 134): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1168G (weak D type 134): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1169C (weak D type 139): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1169C (weak D type 139): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1170C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1170C,1193T (weak D type 41.0.1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1170C,1193T (weak D type 41.0.1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1174delA (RHD*01N.66): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1177C (weak D type 10): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1177C (weak D type 10): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1177C,1199C (weak D type 10.2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1179A (W393*, RHD*01N.76): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1184T (weak D type 82): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1187G (weak D type 91): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1194C (weak D type 75): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1195A (weak D type 45): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1195A (weak D type 45): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1195A (weak D type 45): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1199T (weak D type 126): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1199T (weak D type 126): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1200T (weak D type 127): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1203A (Y401*, RHD*01N.22, DEL17): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1207T (weak D type 128): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1207T (weak D type 128): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1208T (weak D type 129): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1210C (DEL29): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1210C (DEL29): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1212A (weak D type 72): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1212A (weak D type 72): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1215C (weak D type 76): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1222C (DEL10): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1226T (weak D type 42): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1227A (DEL1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1227A (DEL1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1227A (DEL1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1227A (DEL1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1227A,149-29C (IVS1-29C): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1227A,149-29C (IVS1-29C): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1228-1A (IVS9-1A, RHD*01N.77): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1228G (weak D type 78): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1229C (weak D type 140): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1238G (weak D type 83): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1248_1249insG (DEL26): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*124_125delAA (RHD*01N.65): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1250C (weak D type 20): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1250G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1252G (*418E): RH1 (MF144574)
- RHD*1252G (*418E): Prevalence (MF144574)
- RHD*1252T>A (*418K, DEL25): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1252_1253insT (*418L, DEL11): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1269C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*1347G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*143G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*143G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*147delA (DEL4): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*148+1A (IVS1+1A, DEL5): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*148+1T (IVS1+1T, DEL31): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*148+1T (IVS1+1T, DEL31): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*148+5C (IVS1+5C, DEL21): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*149-29C (IVS1-29C, DEL32): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*149-29C (IVS1-29C, DEL32): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*150C,178C,201A,203A,307C (DIIIb Caucasian): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*150C,178C,201A,203A,307C (DIIIb Caucasian): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*150C,178C,201A,203A,307C,702delG (RHD*01N.83): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*150C,178C,201A,203A,307C,702delG (RHD*01N.83): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*150C,178C,201A,203A,602G,667G,957A,1025C (DAR6, DAR(ce2)): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*150C,178C,201A,203A,602G,667G,957A,1025C (DAR6, DAR(ce2)): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*157T (weak D type 104): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*157T (weak D type 104): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*161C (DMH, RHD*23): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*161C (DMH, RHD*23): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*163C (weak D type 130): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*165T (DBO1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*166A,270A (V56M,W90*): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*173T (weak D type 143): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*175A (weak D type 151): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*175A (weak D type 151): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*176A (weak D type 121): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*176A (weak D type 121): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*178C,201A,203A,594T,667G,744T,957A,1025C (weak D type 29): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*178C,689T (RHD*60): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*178C,689T (RHD*60): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*17T (weak D type 31): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*17T (weak D type 31): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*17T (weak D type 31): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*17T,1136T (DAU): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*17T,1136T (DAU): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*182C (weak D type 88): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*182T (weak D type 48): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*186T,410T,455C (DIII type 4): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*186T,410T,455C (DIII type 4): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*186T,410T,455C,1048C (DIVa): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*186T,410T,455C,1048C (DIVa): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*186T,410T,455C,509C,667G (D-SPM, RHD*40): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*186T,410T,455C,509C,667G (D-SPM, RHD*40): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*186T,410T,455C,602G,667G,819A (DIIIa): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*186T,410T,455C,602G,667G,819A (DIIIa): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*186T,410T,455C,667G (DIII type 9): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*186T,410T,455C,667G (DIII type 9): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*186T,602G,667G,819A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*186T,602G,667G,819A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*187T (weak D type 152): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*187T (weak D type 152): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*19T (weak D type 18): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*200G (weak D type 105): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*200G (weak D type 105): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*201A,203A,1136T (DAU14): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*201A,203A,1136T (DAU14): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*203C (weak D type 74): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*203C (weak D type 74): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*208T (weak D type 122): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*208T (weak D type 122): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*208T,210_211insG: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*208T,210_211insG: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*208T,818T,1195A (weak D type 45.2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*209A (weak D type 85): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*209A,998A,1136T (DAU2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*209A,998A,1136T (DAU2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*216_217dupCA,1195G>A (RHD*01N.45): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*216_217dupCA,1195G>A (RHD*01N.45): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*220G (weak D type 106): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*220G (weak D type 106): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*223T (weak D type 107): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*227A (weak D type 84): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*251C (DEL6): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*254G (weak D type 131): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*254G (weak D type 131): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*26A (weak D type 26): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*26G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*26G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*278G (DEL40): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*28T (weak D type 61): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*28T (weak D type 61): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*297_319delCCAGTTCCCTTCTGGGAAGGTGG (RHD*01N.37): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*297_319delCCAGTTCCCTTCTGGGAAGGTGG (RHD*01N.37): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*2C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*2C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*307C (RHD*39): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*307C,329C (DVII type 2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*31T,602G,667G,819A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*31T,602G,667G,819A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*325delA (RHD*01N.11): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*325G (RHD*66): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*325G (RHD*66): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*327_487-4163dup (weak D type 150): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*327_487-4163dup (weak D type 150): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*327_487-4163dup (weak D type 150): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*329C (DVII): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*329C (DVII): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*329C,1054A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*330_331delGT (RHD*01N.35): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*330_331delGT (RHD*01N.35): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*335+1A (IVS2+1A, RHD*01N.24): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*335C (DEL42): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*335T (01N.68): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*335T (01N.68): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*336-1A (IVS2-1A, RHD*01N.25): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*336-2delA (IVS2-2delA, DEL22, RHD*53): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*336-2G (IVS2-2G, DEL33): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*340G (weak D type 47): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*340G (weak D type 47): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*341A (weak D type 25): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*341A (weak D type 25): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*343delC (RHD*01N.23): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*346A (weak D type 117): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*346C (weak D type 116): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*353A,520A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*357C (DBO2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*359A (weak D type 93): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*361A,380C,383G,455C (DIIIc): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*361_371delTTGTCGGTGCT or RHD*356_366delGTGCTTTGTCG (RHD*01N.41): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*364A,602G,667G,744T,1025C (weak D type 4.2.3(S122T)): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*364A,602G,667G,744T,1025C (weak D type 4.2.3(S122T)): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*365T (weak D type 54): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*365T (weak D type 54): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*365T (weak D type 54): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*376C (weak D type 109): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*376C (weak D type 109): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*379T (weak D type 123): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*379T (weak D type 123): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*394A (weak D type 132): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*394C (weak D type 132.0.1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*395A (weak D type 133): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*396_397insGG: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*396_397insGG: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*399T (weak D type 37): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*399T (weak D type 37): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*3A (DEL2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*3A (DEL2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*3A (DEL2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*3A (DEL2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*410A (DEL7): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*410T,455C (DIII type 8): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*410T,455C,509C,667G (DOL4, RHD*12.04): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*410T,455C,509C,667G (DOL4, RHD*12.04): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*410T,455C,602G,667G,819A (DIII type 6): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*410T,455C,602G,667G,819A (DIII type 6): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*413C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*41G (weak D type 145): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*41G (weak D type 145): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*41T (weak D type 136): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*41T (weak D type 136): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*421_422delinsA: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*424delATG (M142del, RHD*01N.74): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*431C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*436A (weak D type 147): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*436A (weak D type 147): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*438C (weak D type 146): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*443G (RHD*01N.73): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*443G (RHD*01N.73): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*443G,584T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*443G,584T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*446A (weak D type 5): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*446A (weak D type 5): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*449delT (L150*, RHD*01N.12): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*452A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*455C (DNT, RHD*38): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*458C (DEL12): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*463G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*46C (DEL43): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*470G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*482G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*486+1A (IVS3+1A, DEL8): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*486+1A (IVS3+1A, DEL8): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*486+1A (IVS3+1A, DEL8): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*486+1A (IVS3+1A, DEL8): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*486+2A (IVS3+2A, DEL9): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*486+2A (IVS3+2A, DEL9): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*486+3C (IVS3+3C): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*486+5A (IVS3+5A): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*487-1A (IVS-1A): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*487_490delACAG or RHD*489_492delAGAC (RHD*01N.13): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*48A (W16*, RHD*01N.08): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*48C (DUC3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*48C,520A,1193T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*48C,520A,1193T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*48C,520A,1193T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*48C,520A,1193T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*48C,602G,667G,819A (weak D type 4.1, DAR4): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*48C,602G,667G,819A (weak D type 4.1, DAR4): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*490A (DDN, RHD*43): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*490A (DDN, RHD*43): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*492A (RHD*61): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*492A (RHD*61): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*492G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*494G (DFL, RHD*28): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*494G (DFL, RHD*28): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*496G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*496G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*497C (DFW, RHD*18): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*497C (DFW, RHD*18): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*497G (DFW2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*497G (DFW2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*4_5delinsTC,6_7insG: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*505C,509G (DFR4, RHD*17.04): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*505C,509G (DFR4, RHD*17.04): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*505C,509G,514T (DFR1, RHD*17.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*505C,509G,514T (DFR1, RHD*17.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*505C,509G,514T (DFR1, RHD*17.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*505C,509G,514T (DFR1, RHD*17.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*505C,509G,514T,539C (DFR3, RHD*17.03): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*505C,509G,514T,539C (DFR3, RHD*17.03): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*509C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*509C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*509C,667G (DOL1, RHD*12.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*509C,667G (DOL1, RHD*12.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*509C,667G,1132G (DOL2, RHD*12.02): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*509C,667G,1132G (DOL2, RHD*12.02): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*510A (DMI, RHD*47): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*510insG: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*510T (DMI-1.1, RHD*47.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*511G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*513A (DHQ, RHD*44): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*519G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*519T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*519T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*520A (weak D type 33): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*520A (weak D type 33): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*520A (weak D type 33): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*520A,1080_1089delCTTCCAGGTC (RHD*01N.36): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*520A,916A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*520A,916A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*520A,919A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*52G,809G (weak D type 1.1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*537G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*539A (weak D type 80): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*539A (weak D type 80): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*53C (DEL3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*542C (weak D type 97): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*542C (weak D type 97): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*542C,1136T (DAU12): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*542C,1136T (DAU12): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*544A,594T,602G (weak D type 14): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*545_548delCTGT (RHD*01N.46): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*545_548delCTGT (RHD*01N.46): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*560C (weak D type 79): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*576T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*576T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*579C (weak D type 144): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*579C (weak D type 144): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*581_582insG (RHD*01N.75): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*594T (weak D type 124): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*594T,602G (weak D type 51): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*594T,602G,667G,819A (weak D type 4.4): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*594T,602G,667G,819A (weak D type 4.4): Prevalence (KX216809)
- RHD*594T,602G,667G,819A (weak D type 4.4): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*59C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*600delG: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G (weak D type 40): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G (weak D type 4.0.1, DAR3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G (weak D type 4.0.1, DAR3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,1025C (weak D type 4.2.0, DAR1.00): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,1025C (weak D type 4.2.0, DAR1.00): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,697C,733C,744T,1136T (DAU): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,697C,733C,744T,1136T (DAU): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,697C,744T,957A,1025C (DAR2.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,697C,744T,957A,1025C (DAR2.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,697C,957A,1025C (DAR2.00): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,697C,957A,1025C (DAR2.00): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,744T,1025C (weak D type 4.2.3, DAR1.03): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,744T,1025C (weak D type 4.2.3, DAR1.03): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,744T,957A,1025C (weak D type 4.2.2, DAR1.02): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,744T,957A,1025C (weak D type 4.2.2, DAR1.02): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,744T,957A,1025C,1063A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,744T,957A,1025C,1063A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,819A (weak D type 4.0, DAR3.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,819A (weak D type 4.0, DAR3.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,819A,1063A (weak D type 4.5): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,819A,872G (weak D type 4.3, DAR5): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,819A,872G (weak D type 4.3, DAR5): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,957A,1025C (weak D type 4.2.1, DAR1.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*602G,667G,957A,1025C (weak D type 4.2.1, DAR1.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*605T (weak D type 43): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*611C (weak D type 19): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*621C (DMA, RHD*35): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*634+5A (IVS4+5A): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*634+5T (IVS4+5T, DEL14): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*634+5T (IVS4+5T, DEL14): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*634T (weak D type 23): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*635-2C (IVS4-2C, RHD*54): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*635-2G (IVS4-2G, DEL19): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*635-2G (IVS4-2G, DEL19): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*635A (weak D type 112): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*635A (weak D type 112): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*648C (weak D type 154): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*648C (weak D type 154): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*658C (weak D type 16): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*660delG or RHD*659delG (RHD*01N.29, RHD*01N.78): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*661A (weak D type 62): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*661T (weak D type 27): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*662G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*667G (DFV, RHD*08.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*667G (DFV, RHD*08.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*667G,676C (DCS1, RHD*16.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*667G,676C (DCS1, RHD*16.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*667G,697C (DV type 1, Kou): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*667G,697C (DV type 1, Kou): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*667G,697C,1122T,1136T (DAU5.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*667G,697C,1122T,1136T (DAU5.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*667G,697C,1136T (DAU5): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*667G,697C,1136T (DAU5): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*667G,819A (DFV.1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*667G,819A (DFV.1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*668C (weak D type 141, RHD*52): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*668C (weak D type 141, RHD*52): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*671G (weak D type 125): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*674T (DSF): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*674T (DSF): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*676C (DCS2, RHD*16.02): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*676C (DCS2, RHD*16.02): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*677A (DCC, RHD*42): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*679delCT: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*67C (weak D type 89): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*67T (weak D type 142): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*67T (weak D type 142): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*680C (DBA, RHD*56): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*680C (DBA, RHD*56): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*683A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*683C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*684_686delGAG (DVL1, RHD*31): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*686A (DHR, RHD*22): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*686A (DHR, RHD*22): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*689A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*689A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*689T,1136T (DAU1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*689T,1136T (DAU1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*68A (weak D type 65): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*68A (weak D type 65): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*697A (DV type 5, DHK): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*697A (DV type 5, DHK): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*697A (DV type 5, DHK): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*697A,1136T (DAU4): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*697A,1136T (DAU4): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*697C (DV type 4, SM): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*697delG (RHD*01N.82): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*700T (DYU, RHD*29): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*700T (DYU, RHD*29): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*705_707delGAA (DVL2, RHD*32): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*710T (weak D type 155): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*711delC (RHD*01N.16): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*711delC (RHD*01N.16): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*711delC (RHD*01N.16): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*712A,809G (weak D type 1.2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*712delG (RHD*01N.33): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*722T (weak D type 67): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*722T (weak D type 67): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*728G (weak D type 44): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*728G (weak D type 44): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*729A (Y243*): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*730C (weak D type 95): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*730C (weak D type 95): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*731T (weak D type 96): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*731T (weak D type 96): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*73T (weak D type 102): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*73T (weak D type 102): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*73T (weak D type 102): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*751C (weak D type 98): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*751C (weak D type 98): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*75dupTCT (L26dup): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*761G (S254*, RHD*01N.62): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*761G (S254*, RHD*01N.62): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*761T,1136T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*761T,1136T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*763A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*766C (weak D type 77): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*767G (S256*, RHD*01N.39): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*780A (weak D type 137): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*780A (weak D type 137): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*782T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*782T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*784delC: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*786delA (DEL13): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*787A (weak D type 100): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*787A (weak D type 100): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*787A (weak D type 100): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*787_788delinsTT,1136T (DAU): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*787_788delinsTT,1136T (DAU): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*78delC (RHD*01N.32): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*79delCTC (L27del): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*79delCTC (L27del): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*801+1A (IVS5+1A, RHD*01N.54): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*801+1A (IVS5+1A, RHD*01N.54): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*801+1T (IVS5+1G>T): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*802-38delTCTC (IVS5-41delCTCT, DEL35): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*802-38delTCTC (IVS5-41delCTCT, DEL35): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*802-38delTCTC (IVS5-41delCTCT, DEL35): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*802-41_802-38delCTCT,1157A (L386*, RHD*01N.58): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*807G (Y269*, RHD*01N.18 ): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*809C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*809G (weak D type 1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*809G (weak D type 1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*809G (weak D type 1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*818T (weak D type 119): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*818T (weak D type 119): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*818T,1195A (weak D type 45.1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*822delG (RHD*01N.48): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*829A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*829A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*830A (weak D type 12): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*830A (weak D type 12): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*830A (weak D type 12): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*833A (weak D type 38): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*835A,1136T (DAU3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*835A,1136T (DAU3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*838A (DEL24): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*841C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*841C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*845A (weak partial D type 15): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*845A (weak partial D type 15): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*845A (weak partial D type 15): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*848T (DHMi, RHD*19): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*851G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*851G: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*851T (DLO, RHD*36): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*851T (DLO, RHD*36): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*863C (DIT1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*871T (weak D type 138): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*871T (weak D type 138): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*872G (DEL41): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*874C (weak D type 113): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*880C (weak D type 9): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*884A (weak D type 135): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*884C (weak D type 94, DEL46): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*884C (weak D type 94, DEL46): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*884C (weak D type 94, DEL46): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*884C (weak D type 94, DEL46): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*885T (weak partial D type 11): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*885T (weak partial D type 11): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*885T (weak partial D type 11): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*895G (weak D type 55): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*896C (RHD*01N.79): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*8G (weak D type 3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*8G (weak D type 3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*8G (weak D type 3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*8G,178C (weak D type 3.1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*8G,49delG: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*915delC (RHD*01N.49): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*916A (weak D type 66): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*916A (weak D type 66): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*916A,932G,1154C (weak D type 2.2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*919A (weak D type 8): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*919A (weak D type 8): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*91A (weak D type 103): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*933A (Y311*, RHD*01N.19): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*933A (Y311*, RHD*01N.19): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*933G (Y311*, RHD*01N.63): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*937A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*938T (weak partial D type 21): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*939+1A (IVS6+1A, RHD*01N.55): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*939+2A (IVS6+2A, RHD*01N.38): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*939+2A (IVS6+2A, RHD*01N.38): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*939+3C (IVS6+3C): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*939A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*939C: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*93A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*93insT (RHD*01N.50, DEL18): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*940-14delTAA (IVS6-14delTAA): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*940-4C (IVS6-4C): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*94insA or RHD*94dupA: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*94insA or RHD*94dupA: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*952T (R318*, RHD*01N.61): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*952T (R318*, RHD*01N.61): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*952T (R318*, RHD*01N.61): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*953A (weak D type 69): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*960A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*960A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*970_972delCAC,976_991delTCCATCATGGGCTACA (RHD*01N.28): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*983A (weak D type 115): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*983A (weak D type 115): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*985_986delinsCA,989C,992T: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*993G (weak D type 90): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*998A,1136T (DAU6): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*998A,1136T (DAU6): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*CE(1-2)-D[361del11]: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*CE(1-3)-D (RHD*01N.43): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*CE(1-8)-D(9-10): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D(1-6)-Ex7?-D(8-10) - partly characterized: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D(329C)-ce(3-9)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D(602G)-CE(5)-D(1025C): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D(602G)-CE(5)-D(1025C): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D(640T)-CE(7)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-ce(2)-DIIIa (DIII type 7): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-ce(2)-DIIIa (DIII type 7): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(2-5)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(2-5)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(2-7)-D (RHD*01N.05): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(3)-weak D type 4.0 (RHD*01N.72): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(3)-weak D type 4.0 (RHD*01N.72): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(3-10): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(3-5)-D (DVI type 4): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(3-6)-D (DVI type 3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(3-6)-D (DVI type 3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(3-6)-D (DVI type 3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-cE(3-7)-D(weak D Type 2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-cE(3-7)-D(weak D Type 2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(4)-D (DFR2, RHD*17.02): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(4)-D (DFR2, RHD*17.02): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-cE(4-5)-D (DVI type 1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-cE(4-5)-D (DVI type 1): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(4-6)-D (DVI type 2): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-cE(4-7)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(4-7)-D (RHD*01N.07): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(4-7)-D (RHD*01N.07): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(4-9)-D (DEL44): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(4-9)-D (DEL44): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(4-9)-D (DEL44): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(5)-D (DV type 2, Hus): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(5)-D (DV type 2, Hus): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(5)-D (DV type 2, Hus): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(5)-D (DV type 2, Hus): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-cE(5-6)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(5-6)[697G]-D (DLX, RHD*46): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-Ce(5-7)-D (D-Ce(5-8)-D, DBT-1, RHD*14.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-Ce(5-7)-D (D-Ce(5-8)-D, DBT-1, RHD*14.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-Ce(5-9)-D (DBT2, RHD*14.02): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-Ce(5-9)-D (DBT2, RHD*14.02): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-cE(5:667-5:697)-D (DBS2, RHD*13.02, RHD*16.03): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(5:667-5:744)-D (DV type 8): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(5:667-5:744)-D (DV type 8): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(5:667-5:744)-D (DV type 8): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(5:667-5:787)-D (DV type 7, DAL): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(5:667-5:787)-D (DV type 7, DAL): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(5:697-5:744)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(6-9)-D (DIV type 3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(6-9)-D (DIV type 3): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(7)-D (RHD*58): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(7-9)-D (DIV type 5): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(7:1048-7:1061)-D (DIV type 4): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(7:1048-9:1193)-D (DIVb): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(8-9)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CE(8-9)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-ceAG(2)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-ceAG(2)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-CEVS(4-7)-D (RHD*01N.06): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-Ex2?-D(3-10) - partly characterized: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D-Ex2?-D(3-10) - partly characterized: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*del82_84TTC (DMW): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Dpsi (RHD*08N.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Dpsi (RHD*08N.01): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Dpsi,1074-214_1074-213insACAG: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Dpsi,1074-214_1074-213insACAG: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Dpsi-OT1: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Dpsi-OT1: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D[667G,697C]-CE(6-9)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*D[667G,697C]-CE(6-9)-D: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex1-3del: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex1-5del: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex10del type 1: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex10del type 2: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex1del (RHD*01N.67): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex1del (RHD*01N.67): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex2del: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex2del: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex3del,602G,667G,819A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex3del,602G,667G,819A: RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex8del (DEL30): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex8del (DEL30): RH (inferred from the reported RHCE phenotypes of the carriers)
- RHD*Ex9del: RH (inferred from the reported RHCE phenotypes of the carriers)
- standard RHD (RHD*01): RH (inferred from the reported RHCE phenotypes of the carriers)
- standard RHD (RHD*01): RH (inferred from the reported RHCE phenotypes of the carriers)
- standard RHD (RHD*01): RH (inferred from the reported RHCE phenotypes of the carriers)
- standard RHD (RHD*01): RH (inferred from the reported RHCE phenotypes of the carriers)