RH1 characterized as D negative (666 entries)
RHeference identifier | Allele |
---|---|
RHef00651 | apparently standard RHD with unexpected serology |
RHef00651 | apparently standard RHD with unexpected serology |
RHef00651 | apparently standard RHD with unexpected serology |
RHef00651 | apparently standard RHD with unexpected serology |
RHef00651 | apparently standard RHD with unexpected serology |
RHef00651 | apparently standard RHD with unexpected serology |
RHef00651 | apparently standard RHD with unexpected serology |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00446 | RHD deletion (RHD*01N.01) |
RHef00657 | RHD deletion - partly characterized |
RHef00657 | RHD deletion - partly characterized |
RHef00657 | RHD deletion - partly characterized |
RHef00746 | D negative - phenotypic description |
RHef00746 | D negative - phenotypic description |
RHef00746 | D negative - phenotypic description |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00447 | RHD*Dpsi (RHD*08N.01) |
RHef00715 | RHD*Dpsi-CE(6)-D |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00122 | RHD*1227A (DEL1) |
RHef00565 | RHD*1227A,149-29C (IVS1-29C) |
RHef00445 | RHD*CE(1-9)-D (RHD*01N.02) |
RHef00445 | RHD*CE(1-9)-D (RHD*01N.02) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00448 | RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00450 | RHD*D-CE(2-7)-D (RHD*01N.05) |
RHef00451 | RHD*D-CEVS(4-7)-D (RHD*01N.06) |
RHef00451 | RHD*D-CEVS(4-7)-D (RHD*01N.06) |
RHef00451 | RHD*D-CEVS(4-7)-D (RHD*01N.06) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00452 | RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01) |
RHef00611 | RHD*D-cE(4-7)-D |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00605 | RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated |
RHef00112 | RHD*CE(1-3)-D (RHD*01N.43) |
RHef00112 | RHD*CE(1-3)-D (RHD*01N.43) |
RHef00112 | RHD*CE(1-3)-D (RHD*01N.43) |
RHef00112 | RHD*CE(1-3)-D (RHD*01N.43) |
RHef00116 | RHD*D-CE(3)-weak D type 4.0 (RHD*01N.72) |
RHef00116 | RHD*D-CE(3)-weak D type 4.0 (RHD*01N.72) |
RHef00116 | RHD*D-CE(3)-weak D type 4.0 (RHD*01N.72) |
RHef00116 | RHD*D-CE(3)-weak D type 4.0 (RHD*01N.72) |
RHef00116 | RHD*D-CE(3)-weak D type 4.0 (RHD*01N.72) |
RHef00117 | RHD*D-CE(4-7)-D (RHD*01N.07) |
RHef00117 | RHD*D-CE(4-7)-D (RHD*01N.07) |
RHef00117 | RHD*D-CE(4-7)-D (RHD*01N.07) |
RHef00117 | RHD*D-CE(4-7)-D (RHD*01N.07) |
RHef00117 | RHD*D-CE(4-7)-D (RHD*01N.07) |
RHef00117 | RHD*D-CE(4-7)-D (RHD*01N.07) |
RHef00117 | RHD*D-CE(4-7)-D (RHD*01N.07) |
RHef00117 | RHD*D-CE(4-7)-D (RHD*01N.07) |
RHef00117 | RHD*D-CE(4-7)-D (RHD*01N.07) |
RHef00118 | RHD*D-CE(4-9)-D (DEL44) |
RHef00118 | RHD*D-CE(4-9)-D (DEL44) |
RHef00118 | RHD*D-CE(4-9)-D (DEL44) |
RHef00118 | RHD*D-CE(4-9)-D (DEL44) |
RHef00118 | RHD*D-CE(4-9)-D (DEL44) |
RHef00118 | RHD*D-CE(4-9)-D (DEL44) |
RHef00118 | RHD*D-CE(4-9)-D (DEL44) |
RHef00118 | RHD*D-CE(4-9)-D (DEL44) |
RHef00120 | RHD*D-CE(8-9)-D |
RHef00120 | RHD*D-CE(8-9)-D |
RHef00120 | RHD*D-CE(8-9)-D |
RHef00120 | RHD*D-CE(8-9)-D |
RHef00120 | RHD*D-CE(8-9)-D |
RHef00444 | RHCE*ce-D(6)-ce (RHD*01N.42) |
RHef00523 | RHCE*D(1)-CE |
RHef00523 | RHCE*D(1)-CE |
RHef00523 | RHCE*D(1)-CE |
RHef00544 | RHD*D-CE(3-10) |
RHef00561 | RHD*CE(1-2)-D[361del11] |
RHef00570 | RHD*Ex3del,602G,667G,819A |
RHef00567 | RHD*Ex10del type 1 |
RHef00524 | RHD*Ex10del type 2 |
RHef00524 | RHD*Ex10del type 2 |
RHef00659 | RHD*D(1-9)-?Ex10? - partly characterized |
RHef00660 | RHDex10del - partly characterized |
RHef00650 | RHD*Ex2del |
RHef00630 | Hybrid RHD*D-CE-D allele - partly characterized |
RHef00630 | Hybrid RHD*D-CE-D allele - partly characterized |
RHef00630 | Hybrid RHD*D-CE-D allele - partly characterized |
RHef00757 | RHD*D(1-6)-Ex7?-D(8-10) - partly characterized |
RHef00758 | RHD*D-Ex2?-D(3-10) - partly characterized |
RHef00759 | RHD*D-CE(3-8/9)-D - partly characterized |
RHef00569 | RHD*D-cE(3-7)-D(weak D Type 2) |
RHef00505 | RHD*Ex1del (RHD*01N.67) |
RHef00505 | RHD*Ex1del (RHD*01N.67) |
RHef00484 | RHD*1228-2del21 (F410fs*, RHD*01N.44) |
RHef00506 | RHD*634+1T,1136T (DAU, RHD*01N.69) |
RHef00506 | RHD*634+1T,1136T (DAU, RHD*01N.69) |
RHef00031 | RHD*D-Ce(5-7)-D (D-Ce(5-8)-D, DBT-1, RHD*14.01) |
RHef00042 | RHD*D-CE(4)-D (DFR2, RHD*17.02) |
RHef00115 | RHD*150C,178C,201A,203A,307C (DIIIb Caucasian) |
RHef00072 | RHD*186T,410T,455C,509C,667G (D-SPM, RHD*40) |
RHef00635 | DIV - partly characterized or subtypes not separated |
RHef00095 | RHD*D-CE(5)-D (DV type 2, Hus) |
RHef00097 | RHD*697C (DV type 4, SM) |
RHef00654 | DV type 2 or DBS1 - subtypes not separated |
RHef00102 | RHD*D-cE(4-5)-D (DVI type 1) |
RHef00103 | RHD*D-CE(4-6)-D (DVI type 2) |
RHef00104 | RHD*D-CE(3-6)-D (DVI type 3) |
RHef00104 | RHD*D-CE(3-6)-D (DVI type 3) |
RHef00409 | RHD*D(329C)-ce(3-9)-D |
RHef00388 | RHD*684_686delGAG (DVL1, RHD*31) |
RHef00389 | RHD*705_707delGAA (DVL2, RHD*32) |
RHef00389 | RHD*705_707delGAA (DVL2, RHD*32) |
RHef00389 | RHD*705_707delGAA (DVL2, RHD*32) |
RHef00238 | RHD*809G (weak D type 1) |
RHef00238 | RHD*809G (weak D type 1) |
RHef00238 | RHD*809G (weak D type 1) |
RHef00238 | RHD*809G (weak D type 1) |
RHef00238 | RHD*809G (weak D type 1) |
RHef00238 | RHD*809G (weak D type 1) |
RHef00238 | RHD*809G (weak D type 1) |
RHef00225 | RHD*712C,809G |
RHef00288 | RHD*1154C (weak D type 2) |
RHef00288 | RHD*1154C (weak D type 2) |
RHef00288 | RHD*1154C (weak D type 2) |
RHef00288 | RHD*1154C (weak D type 2) |
RHef00288 | RHD*1154C (weak D type 2) |
RHef00301 | RHD*8G (weak D type 3) |
RHef00301 | RHD*8G (weak D type 3) |
RHef00301 | RHD*8G (weak D type 3) |
RHef00313 | RHD*602G,667G,819A (weak D type 4.0, DAR3.01) |
RHef00313 | RHD*602G,667G,819A (weak D type 4.0, DAR3.01) |
RHef00314 | RHD*602G,667G (weak D type 4.0.1, DAR3) |
RHef00317 | RHD*602G,667G,744T,957A,1025C (weak D type 4.2.2, DAR1.02) |
RHef00318 | RHD*602G,667G,744T,1025C (weak D type 4.2.3, DAR1.03) |
RHef00626 | weak D type 4 - partly characterized or subtypes not separated |
RHef00626 | weak D type 4 - partly characterized or subtypes not separated |
RHef00626 | weak D type 4 - partly characterized or subtypes not separated |
RHef00602 | weak D type 4.2.x (DAR) - partly characterized or subtypes not separated |
RHef00602 | weak D type 4.2.x (DAR) - partly characterized or subtypes not separated |
RHef00602 | weak D type 4.2.x (DAR) - partly characterized or subtypes not separated |
RHef00319 | RHD*602G,667G,819A,872G (weak D type 4.3, DAR5) |
RHef00319 | RHD*602G,667G,819A,872G (weak D type 4.3, DAR5) |
RHef00319 | RHD*602G,667G,819A,872G (weak D type 4.3, DAR5) |
RHef00333 | RHD*446A (weak D type 5) |
RHef00333 | RHD*446A (weak D type 5) |
RHef00333 | RHD*446A (weak D type 5) |
RHef00333 | RHD*446A (weak D type 5) |
RHef00376 | RHD*880C (weak D type 9) |
RHef00241 | RHD*1177C (weak D type 10) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00197 | RHD*885T (weak partial D type 11) |
RHef00283 | RHD*845A (weak partial D type 15) |
RHef00283 | RHD*845A (weak partial D type 15) |
RHef00283 | RHD*845A (weak partial D type 15) |
RHef00283 | RHD*845A (weak partial D type 15) |
RHef00283 | RHD*845A (weak partial D type 15) |
RHef00283 | RHD*845A (weak partial D type 15) |
RHef00283 | RHD*845A (weak partial D type 15) |
RHef00285 | RHD*340T (weak D type 17) |
RHef00285 | RHD*340T (weak D type 17) |
RHef00286 | RHD*19T (weak D type 18) |
RHef00293 | RHD*1224C (weak D type 22) |
RHef00293 | RHD*1224C (weak D type 22) |
RHef00297 | RHD*26A (weak D type 26) |
RHef00300 | RHD*178C,201A,203A,594T,667G,744T,957A,1025C (weak D type 29) |
RHef00304 | RHD*17T (weak D type 31) |
RHef00304 | RHD*17T (weak D type 31) |
RHef00304 | RHD*17T (weak D type 31) |
RHef00304 | RHD*17T (weak D type 31) |
RHef00305 | RHD*1121A (weak D type 32) |
RHef00305 | RHD*1121A (weak D type 32) |
RHef00311 | RHD*833A (weak D type 38) |
RHef00311 | RHD*833A (weak D type 38) |
RHef00311 | RHD*833A (weak D type 38) |
RHef00311 | RHD*833A (weak D type 38) |
RHef00311 | RHD*833A (weak D type 38) |
RHef00311 | RHD*833A (weak D type 38) |
RHef00322 | RHD*1170C,1193T (weak D type 41.0.1) |
RHef00326 | RHD*1195A (weak D type 45) |
RHef00342 | RHD*1006C (weak D type 58) |
RHef00345 | RHD*28T (weak D type 61) |
RHef00363 | RHD*1228G (weak D type 78) |
RHef00381 | RHD*884C (weak D type 94, DEL46) |
RHef00381 | RHD*884C (weak D type 94, DEL46) |
RHef00267 | RHD*208T (weak D type 122) |
RHef00142 | RHD*1210C (DEL29) |
RHef00160 | RHD*635T (RHD*01N.15) |
RHef00160 | RHD*635T (RHD*01N.15) |
RHef00492 | RHD*922T (G308*, RHD*01N.52, DEL15) |
RHef00492 | RHD*922T (G308*, RHD*01N.52, DEL15) |
RHef00492 | RHD*922T (G308*, RHD*01N.52, DEL15) |
RHef00492 | RHD*922T (G308*, RHD*01N.52, DEL15) |
RHef00163 | RHD*941T (RHD*01N.20) |
RHef00163 | RHD*941T (RHD*01N.20) |
RHef00164 | RHD*1007A (RHD*01N.80) |
RHef00164 | RHD*1007A (RHD*01N.80) |
RHef00164 | RHD*1007A (RHD*01N.80) |
RHef00164 | RHD*1007A (RHD*01N.80) |
RHef00168 | RHD*1154A (RHD*01N.53) |
RHef00168 | RHD*1154A (RHD*01N.53) |
RHef00438 | RHD*1141C |
RHef00406 | RHD*1154T |
RHef00543 | RHD*113A (L38*, DEL39) |
RHef00185 | RHD*896C (RHD*01N.79) |
RHef00185 | RHD*896C (RHD*01N.79) |
RHef00186 | RHD*1010G (DEL38, RHD*01N.57) |
RHef00186 | RHD*1010G (DEL38, RHD*01N.57) |
RHef00496 | RHD*802-41_802-38delCTCT,1157A (L386*, RHD*01N.58) |
RHef00496 | RHD*802-41_802-38delCTCT,1157A (L386*, RHD*01N.58) |
RHef00194 | RHD*3A (DEL2) |
RHef00194 | RHD*3A (DEL2) |
RHef00205 | RHD*872G (DEL41) |
RHef00454 | RHD*121T,643C,646C,988C (RHD*01N.09) |
RHef00497 | RHD*598T (Q200*, RHD*01N.59) |
RHef00497 | RHD*598T (Q200*, RHD*01N.59) |
RHef00497 | RHD*598T (Q200*, RHD*01N.59) |
RHef00497 | RHD*598T (Q200*, RHD*01N.59) |
RHef00502 | RHD*1084T (Q362*, RHD*01N.64) |
RHef00502 | RHD*1084T (Q362*, RHD*01N.64) |
RHef00498 | RHD*1213T (Q405*, RHD*01N.60) |
RHef00498 | RHD*1213T (Q405*, RHD*01N.60) |
RHef00499 | RHD*952T (R318*, RHD*01N.61) |
RHef00499 | RHD*952T (R318*, RHD*01N.61) |
RHef00499 | RHD*952T (R318*, RHD*01N.61) |
RHef00499 | RHD*952T (R318*, RHD*01N.61) |
RHef00499 | RHD*952T (R318*, RHD*01N.61) |
RHef00499 | RHD*952T (R318*, RHD*01N.61) |
RHef00499 | RHD*952T (R318*, RHD*01N.61) |
RHef00499 | RHD*952T (R318*, RHD*01N.61) |
RHef00499 | RHD*952T (R318*, RHD*01N.61) |
RHef00499 | RHD*952T (R318*, RHD*01N.61) |
RHef00499 | RHD*952T (R318*, RHD*01N.61) |
RHef00215 | RHD*335T (01N.68) |
RHef00215 | RHD*335T (01N.68) |
RHef00215 | RHD*335T (01N.68) |
RHef00215 | RHD*335T (01N.68) |
RHef00500 | RHD*761G (S254*, RHD*01N.62) |
RHef00500 | RHD*761G (S254*, RHD*01N.62) |
RHef00481 | RHD*767G (S256*, RHD*01N.39) |
RHef00481 | RHD*767G (S256*, RHD*01N.39) |
RHef00481 | RHD*767G (S256*, RHD*01N.39) |
RHef00219 | RHD*443G (RHD*01N.73) |
RHef00219 | RHD*443G (RHD*01N.73) |
RHef00219 | RHD*443G (RHD*01N.73) |
RHef00219 | RHD*443G (RHD*01N.73) |
RHef00219 | RHD*443G (RHD*01N.73) |
RHef00219 | RHD*443G (RHD*01N.73) |
RHef00219 | RHD*443G (RHD*01N.73) |
RHef00219 | RHD*443G (RHD*01N.73) |
RHef00405 | RHD*443G,584T |
RHef00574 | RHD*150C,186T,410T,455C,543C,609A,654C,667G,674T,807G |
RHef00521 | RHD*166A,270A (V56M,W90*) |
RHef00521 | RHD*166A,270A (V56M,W90*) |
RHef00521 | RHD*166A,270A (V56M,W90*) |
RHef00521 | RHD*166A,270A (V56M,W90*) |
RHef00230 | RHD*46C (DEL43) |
RHef00230 | RHD*46C (DEL43) |
RHef00453 | RHD*48A (W16*, RHD*01N.08) |
RHef00453 | RHD*48A (W16*, RHD*01N.08) |
RHef00453 | RHD*48A (W16*, RHD*01N.08) |
RHef00453 | RHD*48A (W16*, RHD*01N.08) |
RHef00453 | RHD*48A (W16*, RHD*01N.08) |
RHef00453 | RHD*48A (W16*, RHD*01N.08) |
RHef00453 | RHD*48A (W16*, RHD*01N.08) |
RHef00453 | RHD*48A (W16*, RHD*01N.08) |
RHef00455 | RHD*270A (W90*, RHD*01N.10) |
RHef00455 | RHD*270A (W90*, RHD*01N.10) |
RHef00455 | RHD*270A (W90*, RHD*01N.10) |
RHef00459 | RHD*554A (W185*, RHD*01N.14) |
RHef00459 | RHD*554A (W185*, RHD*01N.14) |
RHef00522 | RHD*555A (W185*) |
RHef00510 | RHD*1179A (W393*, RHD*01N.76) |
RHef00510 | RHD*1179A (W393*, RHD*01N.76) |
RHef00231 | RHD*1222C (DEL10) |
RHef00231 | RHD*1222C (DEL10) |
RHef00527 | RHD*1252_1253insT (*418L, DEL11) |
RHef00527 | RHD*1252_1253insT (*418L, DEL11) |
RHef00527 | RHD*1252_1253insT (*418L, DEL11) |
RHef00614 | RHD*729A (Y243*) |
RHef00462 | RHD*807G (Y269*, RHD*01N.18 ) |
RHef00462 | RHD*807G (Y269*, RHD*01N.18 ) |
RHef00462 | RHD*807G (Y269*, RHD*01N.18 ) |
RHef00131 | RHD*932G |
RHef00131 | RHD*932G |
RHef00463 | RHD*933A (Y311*, RHD*01N.19) |
RHef00463 | RHD*933A (Y311*, RHD*01N.19) |
RHef00463 | RHD*933A (Y311*, RHD*01N.19) |
RHef00501 | RHD*933G (Y311*, RHD*01N.63) |
RHef00501 | RHD*933G (Y311*, RHD*01N.63) |
RHef00464 | RHD*990G (Y330*, RHD*01N.21) |
RHef00464 | RHD*990G (Y330*, RHD*01N.21) |
RHef00482 | RHD*1029C>A (Y343*, RHD*01N.40) |
RHef00482 | RHD*1029C>A (Y343*, RHD*01N.40) |
RHef00465 | RHD*1203A (Y401*, RHD*01N.22, DEL17) |
RHef00465 | RHD*1203A (Y401*, RHD*01N.22, DEL17) |
RHef00465 | RHD*1203A (Y401*, RHD*01N.22, DEL17) |
RHef00390 | RHD*424delATG (M142del, RHD*01N.74) |
RHef00390 | RHD*424delATG (M142del, RHD*01N.74) |
RHef00456 | RHD*325delA (RHD*01N.11) |
RHef00456 | RHD*325delA (RHD*01N.11) |
RHef00457 | RHD*449delT (L150*, RHD*01N.12) |
RHef00457 | RHD*449delT (L150*, RHD*01N.12) |
RHef00458 | RHD*487_490delACAG or RHD*489_492delAGAC (RHD*01N.13) |
RHef00458 | RHD*487_490delACAG or RHD*489_492delAGAC (RHD*01N.13) |
RHef00458 | RHD*487_490delACAG or RHD*489_492delAGAC (RHD*01N.13) |
RHef00458 | RHD*487_490delACAG or RHD*489_492delAGAC (RHD*01N.13) |
RHef00458 | RHD*487_490delACAG or RHD*489_492delAGAC (RHD*01N.13) |
RHef00460 | RHD*711delC (RHD*01N.16) |
RHef00460 | RHD*711delC (RHD*01N.16) |
RHef00460 | RHD*711delC (RHD*01N.16) |
RHef00460 | RHD*711delC (RHD*01N.16) |
RHef00460 | RHD*711delC (RHD*01N.16) |
RHef00460 | RHD*711delC (RHD*01N.16) |
RHef00460 | RHD*711delC (RHD*01N.16) |
RHef00461 | RHD*652delA,653G (RHD*01N.17) |
RHef00461 | RHD*652delA,653G (RHD*01N.17) |
RHef00466 | RHD*343delC (RHD*01N.23) |
RHef00466 | RHD*343delC (RHD*01N.23) |
RHef00466 | RHD*343delC (RHD*01N.23) |
RHef00466 | RHD*343delC (RHD*01N.23) |
RHef00466 | RHD*343delC (RHD*01N.23) |
RHef00466 | RHD*343delC (RHD*01N.23) |
RHef00466 | RHD*343delC (RHD*01N.23) |
RHef00466 | RHD*343delC (RHD*01N.23) |
RHef00466 | RHD*343delC (RHD*01N.23) |
RHef00470 | RHD*908_909insTGGCT,939+2_939+5delTAAG (RHD*01N.27) |
RHef00470 | RHD*908_909insTGGCT,939+2_939+5delTAAG (RHD*01N.27) |
RHef00471 | RHD*970_972delCAC,976_991delTCCATCATGGGCTACA (RHD*01N.28) |
RHef00471 | RHD*970_972delCAC,976_991delTCCATCATGGGCTACA (RHD*01N.28) |
RHef00472 | RHD*660delG or RHD*659delG (RHD*01N.29, RHD*01N.78) |
RHef00472 | RHD*660delG or RHD*659delG (RHD*01N.29, RHD*01N.78) |
RHef00472 | RHD*660delG or RHD*659delG (RHD*01N.29, RHD*01N.78) |
RHef00472 | RHD*660delG or RHD*659delG (RHD*01N.29, RHD*01N.78) |
RHef00472 | RHD*660delG or RHD*659delG (RHD*01N.29, RHD*01N.78) |
RHef00472 | RHD*660delG or RHD*659delG (RHD*01N.29, RHD*01N.78) |
RHef00472 | RHD*660delG or RHD*659delG (RHD*01N.29, RHD*01N.78) |
RHef00473 | RHD*745_757delGTGGTGACAGCCA (RHD*01N.30) |
RHef00473 | RHD*745_757delGTGGTGACAGCCA (RHD*01N.30) |
RHef00474 | RHD*78delC (RHD*01N.32) |
RHef00474 | RHD*78delC (RHD*01N.32) |
RHef00475 | RHD*712delG (RHD*01N.33) |
RHef00475 | RHD*712delG (RHD*01N.33) |
RHef00475 | RHD*712delG (RHD*01N.33) |
RHef00475 | RHD*712delG (RHD*01N.33) |
RHef00475 | RHD*712delG (RHD*01N.33) |
RHef00475 | RHD*712delG (RHD*01N.33) |
RHef00476 | RHD*615_616delCA (RHD*01N.34) |
RHef00476 | RHD*615_616delCA (RHD*01N.34) |
RHef00477 | RHD*330_331delGT (RHD*01N.35) |
RHef00477 | RHD*330_331delGT (RHD*01N.35) |
RHef00477 | RHD*330_331delGT (RHD*01N.35) |
RHef00477 | RHD*330_331delGT (RHD*01N.35) |
RHef00478 | RHD*520A,1080_1089delCTTCCAGGTC (RHD*01N.36) |
RHef00478 | RHD*520A,1080_1089delCTTCCAGGTC (RHD*01N.36) |
RHef00479 | RHD*297_319delCCAGTTCCCTTCTGGGAAGGTGG (RHD*01N.37) |
RHef00479 | RHD*297_319delCCAGTTCCCTTCTGGGAAGGTGG (RHD*01N.37) |
RHef00483 | RHD*361_371delTTGTCGGTGCT or RHD*356_366delGTGCTTTGTCG (RHD*01N.41) |
RHef00483 | RHD*361_371delTTGTCGGTGCT or RHD*356_366delGTGCTTTGTCG (RHD*01N.41) |
RHef00483 | RHD*361_371delTTGTCGGTGCT or RHD*356_366delGTGCTTTGTCG (RHD*01N.41) |
RHef00483 | RHD*361_371delTTGTCGGTGCT or RHD*356_366delGTGCTTTGTCG (RHD*01N.41) |
RHef00483 | RHD*361_371delTTGTCGGTGCT or RHD*356_366delGTGCTTTGTCG (RHD*01N.41) |
RHef00483 | RHD*361_371delTTGTCGGTGCT or RHD*356_366delGTGCTTTGTCG (RHD*01N.41) |
RHef00485 | RHD*216_217dupCA,1195G>A (RHD*01N.45) |
RHef00485 | RHD*216_217dupCA,1195G>A (RHD*01N.45) |
RHef00486 | RHD*545_548delCTGT (RHD*01N.46) |
RHef00486 | RHD*545_548delCTGT (RHD*01N.46) |
RHef00486 | RHD*545_548delCTGT (RHD*01N.46) |
RHef00486 | RHD*545_548delCTGT (RHD*01N.46) |
RHef00487 | RHD*745_759delinsAG (RHD*01N.47) |
RHef00488 | RHD*822delG (RHD*01N.48) |
RHef00489 | RHD*915delC (RHD*01N.49) |
RHef00489 | RHD*915delC (RHD*01N.49) |
RHef00490 | RHD*93insT (RHD*01N.50, DEL18) |
RHef00490 | RHD*93insT (RHD*01N.50, DEL18) |
RHef00490 | RHD*93insT (RHD*01N.50, DEL18) |
RHef00490 | RHD*93insT (RHD*01N.50, DEL18) |
RHef00490 | RHD*93insT (RHD*01N.50, DEL18) |
RHef00490 | RHD*93insT (RHD*01N.50, DEL18) |
RHef00490 | RHD*93insT (RHD*01N.50, DEL18) |
RHef00491 | RHD*950delA (RHD*01N.51) |
RHef00467 | RHD*335+1A (IVS2+1A, RHD*01N.24) |
RHef00467 | RHD*335+1A (IVS2+1A, RHD*01N.24) |
RHef00468 | RHD*336-1A (IVS2-1A, RHD*01N.25) |
RHef00468 | RHD*336-1A (IVS2-1A, RHD*01N.25) |
RHef00468 | RHD*336-1A (IVS2-1A, RHD*01N.25) |
RHef00468 | RHD*336-1A (IVS2-1A, RHD*01N.25) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00518 | RHD*486+1A (IVS3+1A, DEL8) |
RHef00519 | RHD*486+2A (IVS3+2A, DEL9) |
RHef00519 | RHD*486+2A (IVS3+2A, DEL9) |
RHef00519 | RHD*486+2A (IVS3+2A, DEL9) |
RHef00519 | RHD*486+2A (IVS3+2A, DEL9) |
RHef00519 | RHD*486+2A (IVS3+2A, DEL9) |
RHef00519 | RHD*486+2A (IVS3+2A, DEL9) |
RHef00519 | RHD*486+2A (IVS3+2A, DEL9) |
RHef00519 | RHD*486+2A (IVS3+2A, DEL9) |
RHef00493 | RHD*801+1A (IVS5+1A, RHD*01N.54) |
RHef00493 | RHD*801+1A (IVS5+1A, RHD*01N.54) |
RHef00493 | RHD*801+1A (IVS5+1A, RHD*01N.54) |
RHef00193 | RHD*802-38delTCTC (IVS5-41delCTCT, DEL35) |
RHef00494 | RHD*939+1A (IVS6+1A, RHD*01N.55) |
RHef00494 | RHD*939+1A (IVS6+1A, RHD*01N.55) |
RHef00480 | RHD*939+2A (IVS6+2A, RHD*01N.38) |
RHef00480 | RHD*939+2A (IVS6+2A, RHD*01N.38) |
RHef00507 | RHD*1073+1T (IVS7+1T, RHD*01N.70) |
RHef00507 | RHD*1073+1T (IVS7+1T, RHD*01N.70) |
RHef00508 | RHD*1074-1A (IVS7-1A, RHD*01N.71) |
RHef00508 | RHD*1074-1A (IVS7-1A, RHD*01N.71) |
RHef00508 | RHD*1074-1A (IVS7-1A, RHD*01N.71) |
RHef00495 | RHD*1073+2C (IVS7+2C, RHD*01N.56) |
RHef00495 | RHD*1073+2C (IVS7+2C, RHD*01N.56) |
RHef00495 | RHD*1073+2C (IVS7+2C, RHD*01N.56) |
RHef00512 | RHD*1074-2C (IVS7-2C, RHD*01N.26) |
RHef00512 | RHD*1074-2C (IVS7-2C, RHD*01N.26) |
RHef00469 | RHD*1153+1A (IVS8+1A, RHD*01N.26) |
RHef00469 | RHD*1153+1A (IVS8+1A, RHD*01N.26) |
RHef00469 | RHD*1153+1A (IVS8+1A, RHD*01N.26) |
RHef00469 | RHD*1153+1A (IVS8+1A, RHD*01N.26) |
RHef00469 | RHD*1153+1A (IVS8+1A, RHD*01N.26) |
RHef00469 | RHD*1153+1A (IVS8+1A, RHD*01N.26) |
RHef00469 | RHD*1153+1A (IVS8+1A, RHD*01N.26) |
RHef00469 | RHD*1153+1A (IVS8+1A, RHD*01N.26) |
RHef00511 | RHD*1228-1A (IVS9-1A, RHD*01N.77) |
RHef00511 | RHD*1228-1A (IVS9-1A, RHD*01N.77) |
RHef00503 | RHD*124_125delAA (RHD*01N.65) |
RHef00503 | RHD*124_125delAA (RHD*01N.65) |
RHef00504 | RHD*1174delA (RHD*01N.66) |
RHef00504 | RHD*1174delA (RHD*01N.66) |
RHef00509 | RHD*581_582insG (RHD*01N.75) |
RHef00509 | RHD*581_582insG (RHD*01N.75) |
RHef00509 | RHD*581_582insG (RHD*01N.75) |
RHef00509 | RHD*581_582insG (RHD*01N.75) |
RHef00513 | RHD*697delG (RHD*01N.82) |
RHef00513 | RHD*697delG (RHD*01N.82) |
RHef00514 | RHD*150C,178C,201A,203A,307C,702delG (RHD*01N.83) |
RHef00514 | RHD*150C,178C,201A,203A,307C,702delG (RHD*01N.83) |
RHef00514 | RHD*150C,178C,201A,203A,307C,702delG (RHD*01N.83) |
RHef00514 | RHD*150C,178C,201A,203A,307C,702delG (RHD*01N.83) |
RHef00515 | RHD*1026T |
RHef00517 | RHD*786delA (DEL13) |
RHef00517 | RHD*786delA (DEL13) |
RHef00525 | RHD*147delA (DEL4) |
RHef00525 | RHD*147delA (DEL4) |
RHef00525 | RHD*147delA (DEL4) |
RHef00526 | RHD*148+1A (IVS1+1A, DEL5) |
RHef00526 | RHD*148+1A (IVS1+1A, DEL5) |
RHef00530 | RHD*635-2G (IVS4-2G, DEL19) |
RHef00530 | RHD*635-2G (IVS4-2G, DEL19) |
RHef00536 | RHD*993delC (DEL28) |
RHef00538 | RHD*148+1T (IVS1+1T, DEL31) |
RHef00539 | RHD*149-29C (IVS1-29C, DEL32) |
RHef00540 | RHD*336-2G (IVS2-2G, DEL33) |
RHef00542 | RHD*1154-31T (IVS8-31T, DEL37) |
RHef00542 | RHD*1154-31T (IVS8-31T, DEL37) |
RHef00542 | RHD*1154-31T (IVS8-31T, DEL37) |
RHef00632 | RHD*1154-1C (IVS8-1C) |
RHef00649 | RHD*486+5A (IVS3+5A) |
RHef00681 | RHD*1073+1A (IVS7+1A) |
RHef00681 | RHD*1073+1A (IVS7+1A) |
RHef00710 | RHD*336-3T (IVS4+1A) |
RHef00712 | RHD*801+2A (IVS5+2A) |
RHef00712 | RHD*801+2A (IVS5+2A) |
RHef00712 | RHD*801+2A (IVS5+2A) |
RHef00722 | RHD*148+2delT (IVS1+2delT) |
RHef00736 | RHD*1073+2A (IVS7+2A) |
RHef00563 | RHD*634+1T (IVS4+1T) |
RHef00564 | RHD*208T,210_211insG |
RHef00576 | RHD*940-14delTAA (IVS6-14delTAA) |
RHef00598 | M1 |
RHef00599 | M2 |
RHef00600 | M3 |
RHef00601 | M4 |
RHef00631 | RHD*413C |
RHef00663 | Partial D - partly characterized |
RHef00664 | RHD*1347G |
RHef00684 | RHD*1001A (W334*) |
RHef00716 | RHD*948A (C316*) |
RHef00719 | RHD*1151G |
RHef00719 | RHD*1151G |
RHef00719 | RHD*1151G |
RHef00680 | RHD*53delT |
RHef00685 | RHD*396_397insGG |
RHef00707 | RHD*1166delA |
RHef00708 | RHD*93delC (RHD*01N.31) |
RHef00619 | RHD*600delG |
RHef00709 | RHD*683del16 |
RHef00737 | RHD*679delCT |
RHef00648 | RHCE*ce48C,697G,733G (ceCF, ce.20.06) |
RHef00755 | RHCE*ce733 - partly characterized or subtypes not seperated |
RHef00772 | RHD*DIIIa-CE(4-9)-D |
RHef00773 | RHD*Ex1-5del |
RHef00774 | RHD*486+1A,1195A (IVS3+1A) |
RHef00775 | RHD*156delA,241T |
RHef00776 | RHD*346_354delGCCACCATG |
RHef00789 | RHD*4_5delinsTC,6_7insG |
RHef00793 | RHD*829A |
RHef00794 | RHD*421_422delinsA |
RHef00795 | RHD*784delC |
RHef00796 | RHD*519G |
RHef00798 | RHD*1154C,1163G |
RHef00799 | RHD*8G,49delG |
RHef00800 | RHD*Ex1-3del |