RHD*01N.44
(ISBT table: RHD negative v4.0)
This entry is an RHD allele.
RHD(1228-2del21), RHD*1228-1_1248delTTTCCTCATTTGGCTGTTGGA, RHD*1228-2del21, RHD*1228-2del21 (F410fs*, RHD*01N.44),
Molecular data
Nucleotides:
1228del22;
Amino acids: F410Ffs*1;
Hybrid allele encompassing at least one RHCE exon:
RHD(1-9)-del(Ex10)
Comments on the molecular basis:
- see also "Additional comments" section on the RhesusBase http://www.rhesusbase.info/RHDRHD(1228-2del21).htm
Extracellular position of one or more amino acid substitutions:
- None of the mutations are predicted to affect an extracellular amino acid. However, the effect of the deletion of Exon 10 on the RhD protein structure is unknown.
Splicing:
Unconventional prediction methods:
Phenotype
Main D phenotype: D negative (DEL not excluded) (last update: May 19, 2020)Reports by D phenotype
Other RH phenotypes: RH:
Serology with monoclonal anti-D
Antigen Density (Ag/RBC)
More phenotype data
Rhesus Similarity Index
Haplotype
Main CcEe phenotype association: unknown (last update: Dec. 9, 2020)ce | Ce | cE | CE | |
---|---|---|---|---|
ce | 0 | 0 | 0 | 0 |
Ce | 0 | 0 | 0 | |
cE | 0 | 0 | ||
CE | 0 |
Reports by CcEe phenotype
Reports by allele association
Alloimmunization
Antibodies in carriers
Antibody specificity: D (RH1)
Summary: D negative, at risk for anti-D (last update: Aug. 25, 2020)Detailed information
Antibodies in D negative recipients
Alloimmunization in recipients: not expected, see phenotype data
Reports
Summary: exceptional description(s), possibly in the German population (last update: Dec. 22, 2019)Structure mapping
Movement | Mouse Input | Touch Input | ||
---|---|---|---|---|
Rotation | Primary Mouse Button | Single touch | ||
Translation | Middle Mouse Button or Ctrl+Primary | Triple touch | ||
Zoom | Scroll Wheel or Second Mouse Button or Shift+Primary | Pinch (double touch) | ||
Slab | Ctrl+Second | Not Available |
References
- International Society of Blood Transfusion et al. International Society of Blood Transfusion (ISBT) allele table Online ressource, 1935. — Online ressource — [RHeference]
- National Center for Biotechnology Information et al. Data from Genbank submission Online ressource, 1982. — Online ressource — [RHeference]
- Wagner FF and Flegel WA et al. The Human RhesusBase Online ressource, 2011. — Online ressource — [RHeference]
- Floch A et al. Comment from Rheference Online ressource, 2020. — Online ressource — [RHeference]
Last update: Jan. 11, 2021