RHeference
  • Allele
    • List
    • Search
  • References
    • All
    • By Author
    • By Journal
  • Documentation
  • Statistics
  • Search
    • By name
    • By mutation
    • In exons
    • Complex
  • Contact

Online ressource

This reference was identified in a congress abstract or in an online resource.

International Society of Blood Transfusion (ISBT) allele table. International Society of Blood Transfusion. Online ressource, 1935.

Remark: vol. since 1935

Annotations by Allele

  • RHCE*ce-D(6)-ce (RHD*01N.42): RH1 (ISBT classification)
  • RHCE*ce48C,365T (ceSL.01 (48C,+/-105G,365T)): RH1 (ISBT classification)
  • RHCE*ce667T,697G,712G,733G,744C,787G,800A (ceHAR, ce.22): RH
  • RHCE*ce667T,697G,712G,733G,744C,787G,800A (ceHAR, ce.22): RH1 (ISBT classification)
  • RHCE*ce667T,697G,712G,733G,744C,787G,800A (ceHAR, ce.22): RH
  • RHCE*ce697G,712G,733G,744C (RHCE*ce37): RH1 (ISBT classification)
  • RHD deletion (RHD*01N.01): RH1 (ISBT classification)
  • RHD*1006C (weak D type 58): RH1 (ISBT classification)
  • RHD*1007A (RHD*01N.80): RH1 (ISBT classification)
  • RHD*1010G (DEL38, RHD*01N.57): RH1 (ISBT classification)
  • RHD*1010G (DEL38, RHD*01N.57): RH1 (ISBT classification)
  • RHD*1012G (weak D type 70): RH1 (ISBT classification)
  • RHD*1013C (weak D type 24): RH1 (ISBT classification)
  • RHD*1015A (weak D type 39): RH1 (ISBT classification)
  • RHD*1016A (weak D type 7): RH1 (ISBT classification)
  • RHD*1018_1019delinsAT (weak D type 30): RH1 (ISBT classification)
  • RHD*1029C>A (Y343*, RHD*01N.40): RH1 (ISBT classification)
  • RHD*1034A (weak D type 86): RH1 (ISBT classification)
  • RHD*1073+152A,1227A (IVS7+152A, DEL36): RH1 (ISBT classification)
  • RHD*1073+1T (IVS7+1T, RHD*01N.70): RH1 (ISBT classification)
  • RHD*1073+2C (IVS7+2C, RHD*01N.56): RH1 (ISBT classification)
  • RHD*1074-1A (IVS7-1A, RHD*01N.71): RH1 (ISBT classification)
  • RHD*1074-2C (IVS7-2C, RHD*01N.26): RH1 (ISBT classification)
  • RHD*1084T (Q362*, RHD*01N.64): RH1 (ISBT classification)
  • RHD*1107C (weak D type 99): RH1 (ISBT classification)
  • RHD*1121A (weak D type 32): RH1 (ISBT classification)
  • RHD*113A (L38*, DEL39): RH1 (ISBT classification)
  • RHD*1145C (weak D type 92): RH1 (ISBT classification)
  • RHD*1145C,1177C (weak D type 10.1): RH1 (ISBT classification)
  • RHD*1148C (weak D type 59): RH1 (ISBT classification)
  • RHD*1152C (weak D type 28): RH1 (ISBT classification)
  • RHD*1153+1A (IVS8+1A, RHD*01N.26): RH1 (ISBT classification)
  • RHD*1154-31T (IVS8-31T, DEL37): RH1 (ISBT classification)
  • RHD*1154-8A (IVS8-8A, DEL20): RH1 (ISBT classification)
  • RHD*1154A (RHD*01N.53): RH1 (ISBT classification)
  • RHD*1154C (weak D type 2): RH1 (ISBT classification)
  • RHD*1168G (weak D type 134): RH1 (ISBT classification)
  • RHD*1169C (weak D type 139): RH1 (ISBT classification)
  • RHD*1170C,1193T (weak D type 41.0.1): RH1 (ISBT classification)
  • RHD*1174delA (RHD*01N.66): RH1 (ISBT classification)
  • RHD*1177C (weak D type 10): RH1 (ISBT classification)
  • RHD*1177C,1199C (weak D type 10.2): RH1 (ISBT classification)
  • RHD*1179A (W393*, RHD*01N.76): RH1 (ISBT classification)
  • RHD*1184T (weak D type 82): RH1 (ISBT classification)
  • RHD*1187G (weak D type 91): RH1 (ISBT classification)
  • RHD*1193T (weak D type 41): RH1 (ISBT classification)
  • RHD*1194C (weak D type 75): RH1 (ISBT classification)
  • RHD*1195A (weak D type 45): RH1 (ISBT classification)
  • RHD*1199C (weak D type 81): RH1 (ISBT classification)
  • RHD*1199T (weak D type 126): RH1 (ISBT classification)
  • RHD*1200T (weak D type 127): RH1 (ISBT classification)
  • RHD*1203A (Y401*, RHD*01N.22, DEL17): RH1 (ISBT classification)
  • RHD*1203A (Y401*, RHD*01N.22, DEL17): RH1 (ISBT classification)
  • RHD*1207T (weak D type 128): RH1 (ISBT classification)
  • RHD*1208T (weak D type 129): RH1 (ISBT classification)
  • RHD*1210C (DEL29): RH1 (ISBT classification)
  • RHD*1212A (weak D type 72): RH1 (ISBT classification)
  • RHD*1213T (Q405*, RHD*01N.60): RH1 (ISBT classification)
  • RHD*1215C (weak D type 76): RH1 (ISBT classification)
  • RHD*1219_1224delTTCTGG (weak D type 60): RH1 (ISBT classification)
  • RHD*121T,643C,646C,988C (RHD*01N.09): RH1 (ISBT classification)
  • RHD*1221A (weak D type 46): RH1 (ISBT classification)
  • RHD*1222C (DEL10): RH1 (ISBT classification)
  • RHD*1224C (weak D type 22): RH1 (ISBT classification)
  • RHD*1226T (weak D type 42): RH1 (ISBT classification)
  • RHD*1227A (DEL1): RH1 (ISBT classification)
  • RHD*1228-1A (IVS9-1A, RHD*01N.77): RH1 (ISBT classification)
  • RHD*1228-2del21 (F410fs*, RHD*01N.44): RH1 (ISBT classification)
  • RHD*1228G (weak D type 78): RH1 (ISBT classification)
  • RHD*1229C (weak D type 140): RH1 (ISBT classification)
  • RHD*1238G (weak D type 83): RH1 (ISBT classification)
  • RHD*1241T (weak D type 73): RH1 (ISBT classification)
  • RHD*1248_1249insG (DEL26): RH1 (ISBT classification)
  • RHD*124_125delAA (RHD*01N.65): RH1 (ISBT classification)
  • RHD*1250C (weak D type 20): RH1 (ISBT classification)
  • RHD*1252T>A (*418K, DEL25): RH1 (ISBT classification)
  • RHD*1252_1253insT (*418L, DEL11): RH1 (ISBT classification)
  • RHD*147delA (DEL4): RH1 (ISBT classification)
  • RHD*148+1A (IVS1+1A, DEL5): RH1 (ISBT classification)
  • RHD*148+1T (IVS1+1T, DEL31): RH1 (ISBT classification)
  • RHD*148+5C (IVS1+5C, DEL21): RH1 (ISBT classification)
  • RHD*149-29C (IVS1-29C, DEL32): RH1 (ISBT classification)
  • RHD*150C,178C,201A,203A,307C (DIIIb Caucasian): RH
  • RHD*150C,178C,201A,203A,307C (DIIIb Caucasian): RH
  • RHD*150C,178C,201A,203A,307C,702delG (RHD*01N.83): RH1 (ISBT classification)
  • RHD*157T (weak D type 104): RH1 (ISBT classification)
  • RHD*163C (weak D type 130): RH1 (ISBT classification)
  • RHD*165T,1213G (weak D type 68): RH1 (ISBT classification)
  • RHD*173T (weak D type 143): RH1 (ISBT classification)
  • RHD*176A (weak D type 121): RH1 (ISBT classification)
  • RHD*178C,201A,203A,594T,667G,744T,957A,1025C (weak D type 29): RH1 (ISBT classification)
  • RHD*178C,689T (RHD*60): RH1 (ISBT classification)
  • RHD*17T (weak D type 31): RH1 (ISBT classification)
  • RHD*182C (weak D type 88): RH1 (ISBT classification)
  • RHD*182T (weak D type 48): RH1 (ISBT classification)
  • RHD*186T,410T,455C,1048C (DIVa): RH
  • RHD*186T,410T,455C,602G,667G,819A (DIIIa): RH
  • RHD*19T (weak D type 18): RH1 (ISBT classification)
  • RHD*200G (weak D type 105): RH1 (ISBT classification)
  • RHD*203C (weak D type 74): RH1 (ISBT classification)
  • RHD*208T (weak D type 122): RH1 (ISBT classification)
  • RHD*208T,818T,1195A (weak D type 45.2): RH1 (ISBT classification)
  • RHD*209A (weak D type 85): RH1 (ISBT classification)
  • RHD*216_217dupCA,1195G>A (RHD*01N.45): RH1 (ISBT classification)
  • RHD*220G (weak D type 106): RH1 (ISBT classification)
  • RHD*223T (weak D type 107): RH1 (ISBT classification)
  • RHD*227A (weak D type 84): RH1 (ISBT classification)
  • RHD*251C (DEL6): RH1 (ISBT classification with comment "Del or weak D")
  • RHD*251C (DEL6): RH1 (ISBT classification with comment "Del or weak D")
  • RHD*254G (weak D type 131): RH1 (ISBT classification)
  • RHD*260A (weak D type 35): RH1 (ISBT classification)
  • RHD*26A (weak D type 26): RH1 (ISBT classification)
  • RHD*270A (W90*, RHD*01N.10): RH1 (ISBT classification)
  • RHD*278G (DEL40): RH1 (ISBT classification)
  • RHD*287A (weak D type 108): RH1 (ISBT classification)
  • RHD*28T (weak D type 61): RH1 (ISBT classification)
  • RHD*297_319delCCAGTTCCCTTCTGGGAAGGTGG (RHD*01N.37): RH1 (ISBT classification)
  • RHD*29A (weak D type 6): RH1 (ISBT classification)
  • RHD*29C (weak D type 71): RH1 (ISBT classification)
  • RHD*301A,1154C (weak D type 2.1): RH1 (ISBT classification)
  • RHD*307C (RHD*39): RH
  • RHD*325delA (RHD*01N.11): RH1 (ISBT classification)
  • RHD*329C (DVII): RH
  • RHD*330_331delGT (RHD*01N.35): RH1 (ISBT classification)
  • RHD*335+1A (IVS2+1A, RHD*01N.24): RH1 (ISBT classification)
  • RHD*335C (DEL42): RH1 (ISBT classification)
  • RHD*335T (01N.68): RH1 (ISBT classification)
  • RHD*336-1A (IVS2-1A, RHD*01N.25): RH1 (ISBT classification)
  • RHD*336-2delA (IVS2-2delA, DEL22, RHD*53): RH1 (ISBT classification)
  • RHD*336-2G (IVS2-2G, DEL33): RH1 (ISBT classification)
  • RHD*340G (weak D type 47): RH1 (ISBT classification)
  • RHD*340T (weak D type 17): RH1 (ISBT classification)
  • RHD*341A (weak D type 25): RH1 (ISBT classification)
  • RHD*343delC (RHD*01N.23): RH1 (ISBT classification)
  • RHD*346A (weak D type 117): RH1 (ISBT classification)
  • RHD*346C (weak D type 116): RH1 (ISBT classification)
  • RHD*347T (weak D type 118): RH1 (ISBT classification)
  • RHD*359A (weak D type 93): RH1 (ISBT classification)
  • RHD*361_371delTTGTCGGTGCT or RHD*356_366delGTGCTTTGTCG (RHD*01N.41): RH1 (ISBT classification)
  • RHD*365T (weak D type 54): RH1 (ISBT classification)
  • RHD*374A (weak D type 87): RH1 (ISBT classification)
  • RHD*376C (weak D type 109): RH1 (ISBT classification)
  • RHD*379T (weak D type 123): RH1 (ISBT classification)
  • RHD*394A (weak D type 132): RH1 (ISBT classification)
  • RHD*395A (weak D type 133): RH1 (ISBT classification)
  • RHD*399T (weak D type 37): RH1 (ISBT classification)
  • RHD*3A (DEL2): RH1 (ISBT classification)
  • RHD*410A (DEL7): RH1 (ISBT classification with comment "Del or weak D")
  • RHD*410A (DEL7): RH1 (ISBT classification with comment "Del or weak D")
  • RHD*413G (weak D type 110): RH1 (ISBT classification)
  • RHD*41G (weak D type 145): RH1 (ISBT classification)
  • RHD*41T (weak D type 136): RH1 (ISBT classification)
  • RHD*424delATG (M142del, RHD*01N.74): RH1 (ISBT classification)
  • RHD*443G (RHD*01N.73): RH1 (ISBT classification)
  • RHD*446A (weak D type 5): RH1 (ISBT classification)
  • RHD*449delT (L150*, RHD*01N.12): RH1 (ISBT classification)
  • RHD*458C (DEL12): RH1 (ISBT classification)
  • RHD*46C (DEL43): RH1 (ISBT classification)
  • RHD*486+1A (IVS3+1A, DEL8): RH1 (ISBT classification)
  • RHD*486+2A (IVS3+2A, DEL9): RH1 (ISBT classification with comment "Del or D negative")
  • RHD*486+2A (IVS3+2A, DEL9): RH1 (ISBT classification with comment "Del or D negative")
  • RHD*487_490delACAG or RHD*489_492delAGAC (RHD*01N.13): RH1 (ISBT classification)
  • RHD*48A (W16*, RHD*01N.08): RH1 (ISBT classification)
  • RHD*48C (DUC3): RH1 (ISBT classification)
  • RHD*48C,602G,667G,819A (weak D type 4.1, DAR4): RH1 (ISBT classification)
  • RHD*492A (RHD*61): RH1 (ISBT classification)
  • RHD*509C,667G,1132G (DOL2, RHD*12.02): RH
  • RHD*520A (weak D type 33): RH1 (ISBT classification)
  • RHD*520A,1080_1089delCTTCCAGGTC (RHD*01N.36): RH1 (ISBT classification)
  • RHD*52G,809G (weak D type 1.1): RH1 (ISBT classification)
  • RHD*539A (weak D type 80): RH1 (ISBT classification)
  • RHD*53C (DEL3): RH1 (ISBT classification)
  • RHD*542C (weak D type 97): RH1 (ISBT classification)
  • RHD*544A,594T,602G (weak D type 14): RH1 (ISBT classification)
  • RHD*545_548delCTGT (RHD*01N.46): RH1 (ISBT classification)
  • RHD*554A (W185*, RHD*01N.14): RH1 (ISBT classification)
  • RHD*560C (weak D type 79): RH1 (ISBT classification)
  • RHD*579C (weak D type 144): RH1 (ISBT classification)
  • RHD*581_582insG (RHD*01N.75): RH1 (ISBT classification)
  • RHD*594T (weak D type 124): RH1 (ISBT classification)
  • RHD*594T,602G (weak D type 51): RH1 (ISBT classification)
  • RHD*598T (Q200*, RHD*01N.59): RH1 (ISBT classification)
  • RHD*602G (weak D type 40): RH1 (ISBT classification)
  • RHD*602G,667G (weak D type 4.0.1, DAR3): RH1 (ISBT classification)
  • RHD*602G,667G,744T,1025C (weak D type 4.2.3, DAR1.03): RH1 (ISBT classification)
  • RHD*602G,667G,744T,957A,1025C (weak D type 4.2.2, DAR1.02): RH1 (ISBT classification)
  • RHD*602G,667G,819A (weak D type 4.0, DAR3.01): RH1 (ISBT classification)
  • RHD*602G,667G,819A,872G (weak D type 4.3, DAR5): RH1 (ISBT classification)
  • RHD*602G,667G,819A,872G (weak D type 4.3, DAR5): RH1 (ISBT classification)
  • RHD*602G,667G,957A,1025C (weak D type 4.2.1, DAR1.01): RH1 (ISBT classification)
  • RHD*605T (weak D type 43): RH1 (ISBT classification)
  • RHD*611C (weak D type 19): RH1 (ISBT classification)
  • RHD*615_616delCA (RHD*01N.34): RH1 (ISBT classification)
  • RHD*62C (weak D type 101): RH1 (ISBT classification)
  • RHD*634+1T,1136T (DAU, RHD*01N.69): RH1 (ISBT classification)
  • RHD*634+5T (IVS4+5T, DEL14): RH1 (ISBT classification)
  • RHD*634A (weak D type 111): RH1 (ISBT classification)
  • RHD*634C (DEL16): RH1 (ISBT classification)
  • RHD*634T (weak D type 23): RH1 (ISBT classification)
  • RHD*635-2G (IVS4-2G, DEL19): RH1 (ISBT classification)
  • RHD*635A (weak D type 112): RH1 (ISBT classification)
  • RHD*635T (RHD*01N.15): RH1 (ISBT classification)
  • RHD*640T (weak partial D type 57): RH1 (ISBT classification)
  • RHD*652delA,653G (RHD*01N.17): RH1 (ISBT classification)
  • RHD*658C (weak D type 16): RH1 (ISBT classification)
  • RHD*65A (weak D type 56): RH1 (ISBT classification)
  • RHD*660delG or RHD*659delG (RHD*01N.29, RHD*01N.78): RH1 (ISBT classification)
  • RHD*661A (weak D type 62): RH1 (ISBT classification)
  • RHD*661T (weak D type 27): RH1 (ISBT classification)
  • RHD*668C (weak D type 141, RHD*52): RH1 (ISBT classification)
  • RHD*671G (weak D type 125): RH1 (ISBT classification)
  • RHD*67C (weak D type 89): RH1 (ISBT classification)
  • RHD*67T (weak D type 142): RH1 (ISBT classification)
  • RHD*68A (weak D type 65): RH1 (ISBT classification)
  • RHD*697delG (RHD*01N.82): RH1 (ISBT classification)
  • RHD*711delC (RHD*01N.16): RH1 (ISBT classification)
  • RHD*712A,809G (weak D type 1.2): RH1 (ISBT classification)
  • RHD*712delG (RHD*01N.33): RH1 (ISBT classification)
  • RHD*721C (DEL45): RH1 (ISBT classification)
  • RHD*722T (weak D type 67): RH1 (ISBT classification)
  • RHD*727A (weak D type 50): RH1 (ISBT classification)
  • RHD*728G (weak D type 44): RH1 (ISBT classification)
  • RHD*730C (weak D type 95): RH1 (ISBT classification)
  • RHD*731T (weak D type 96): RH1 (ISBT classification)
  • RHD*73T (weak D type 102): RH1 (ISBT classification)
  • RHD*740G (weak D type 53): RH1 (ISBT classification)
  • RHD*745_757delGTGGTGACAGCCA (RHD*01N.30): RH1 (ISBT classification)
  • RHD*745_759delinsAG (RHD*01N.47): RH1 (ISBT classification)
  • RHD*751C (weak D type 98): RH1 (ISBT classification)
  • RHD*758A (weak D type 63): RH1 (ISBT classification)
  • RHD*761G (S254*, RHD*01N.62): RH1 (ISBT classification)
  • RHD*766C (weak D type 77): RH1 (ISBT classification)
  • RHD*767G (S256*, RHD*01N.39): RH1 (ISBT classification)
  • RHD*770T (weak D type 49): RH1 (ISBT classification)
  • RHD*780A (weak D type 137): RH1 (ISBT classification)
  • RHD*786delA (DEL13): RH1 (ISBT classification with comment: "Del or D negative")
  • RHD*786delA (DEL13): RH1 (ISBT classification with comment "Del or D negative")
  • RHD*787A (weak D type 100): RH1 (ISBT classification)
  • RHD*78delC (RHD*01N.32): RH1 (ISBT classification)
  • RHD*801+1A (IVS5+1A, RHD*01N.54): RH1 (ISBT classification)
  • RHD*802-38delTCTC (IVS5-41delCTCT, DEL35): RH1 (previously classified as Del phenotype in the ISBT classification)
  • RHD*802-41_802-38delCTCT,1157A (L386*, RHD*01N.58): RH1 (ISBT classification)
  • RHD*807G (Y269*, RHD*01N.18 ): RH1 (ISBT classification)
  • RHD*809A (weak D type 34): RH1 (ISBT classification)
  • RHD*809G (weak D type 1): RH1 (ISBT classification)
  • RHD*818A (weak D type 120): RH1 (ISBT classification)
  • RHD*818T (weak D type 119): RH1 (ISBT classification)
  • RHD*818T,1195A (weak D type 45.1): RH1 (ISBT classification)
  • RHD*822delG (RHD*01N.48): RH1 (ISBT classification)
  • RHD*826C (weak D type 13): RH1 (ISBT classification)
  • RHD*830A (weak D type 12): RH1 (ISBT classification)
  • RHD*833A (weak D type 38): RH1 (ISBT classification)
  • RHD*838A (DEL24): RH1 (ISBT classification)
  • RHD*842G (weak D type 36): RH1 (ISBT classification)
  • RHD*845A (weak partial D type 15): RH1 (ISBT classification with comment "weak partial phenotype")
  • RHD*871T (weak D type 138): RH1 (ISBT classification)
  • RHD*872G (DEL41): RH1 (ISBT classification)
  • RHD*874C (weak D type 113): RH1 (ISBT classification)
  • RHD*880C (weak D type 9): RH1 (ISBT classification)
  • RHD*881T (weak D type 64): RH1 (ISBT classification)
  • RHD*884A (weak D type 135): RH1 (ISBT classification)
  • RHD*884C (weak D type 94, DEL46): RH1 (ISBT classification)
  • RHD*884C (weak D type 94, DEL46): RH1 (ISBT classification)
  • RHD*885T (weak partial D type 11): RH1 (ISBT classification with comments "Del phenotype when with Ce" and "weak partial or Del phenotype")
  • RHD*885T (weak partial D type 11): RH1 (ISBT classification with comment "Del phenotype when with Ce"; "weak partial or Del phenotype")
  • RHD*895G (weak D type 55): RH1 (ISBT classification)
  • RHD*896C (RHD*01N.79): RH1 (ISBT classification)
  • RHD*8G (weak D type 3): RH1 (ISBT classification)
  • RHD*8G,178C (weak D type 3.1): RH1 (ISBT classification)
  • RHD*908_909insTGGCT,939+2_939+5delTAAG (RHD*01N.27): RH1 (ISBT classification)
  • RHD*915delC (RHD*01N.49): RH1 (ISBT classification)
  • RHD*916A (weak D type 66): RH1 (ISBT classification)
  • RHD*916A,932G,1154C (weak D type 2.2): RH1 (ISBT classification)
  • RHD*919A (weak D type 8): RH1 (ISBT classification)
  • RHD*91A (weak D type 103): RH1 (ISBT classification)
  • RHD*922T (G308*, RHD*01N.52, DEL15): RH1 (ISBT classification; also classified as D negative)
  • RHD*922T (G308*, RHD*01N.52, DEL15): RH1 (ISBT classification; also classified as Del)
  • RHD*92C (weak D type 52): RH1 (ISBT classification)
  • RHD*933A (Y311*, RHD*01N.19): RH1 (ISBT classification)
  • RHD*933G (Y311*, RHD*01N.63): RH1 (ISBT classification)
  • RHD*939+1A (IVS6+1A, RHD*01N.55): RH1 (ISBT classification)
  • RHD*939+2A (IVS6+2A, RHD*01N.38): RH1 (ISBT classification)
  • RHD*93delC (RHD*01N.31): RH1 (ISBT classification)
  • RHD*93insT (RHD*01N.50, DEL18): RH1 (ISBT classification)
  • RHD*93insT (RHD*01N.50, DEL18): RH1 (ISBT classification)
  • RHD*941T (RHD*01N.20): RH1 (ISBT classification)
  • RHD*950delA (RHD*01N.51): RH1 (ISBT classification)
  • RHD*952T (R318*, RHD*01N.61): RH1 (ISBT classification)
  • RHD*953A (weak D type 69): RH1 (ISBT classification)
  • RHD*968T (weak D type 114): RH1 (ISBT classification)
  • RHD*970_972delCAC,976_991delTCCATCATGGGCTACA (RHD*01N.28): RH1 (ISBT classification)
  • RHD*983A (weak D type 115): RH1 (ISBT classification)
  • RHD*990G (Y330*, RHD*01N.21): RH1 (ISBT classification)
  • RHD*993delC (DEL28): RH1 (ISBT classification)
  • RHD*993G (weak D type 90): RH1 (ISBT classification)
  • RHD*CE(1-3)-D (RHD*01N.43): RH1 (ISBT classification)
  • RHD*CE(1-9)-D (RHD*01N.02): RH1 (ISBT classification)
  • RHD*D-CE(2-7)-D (RHD*01N.05): RH1 (ISBT classification)
  • RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04): RH1 (ISBT classification)
  • RHD*D-CE(3)-weak D type 4.0 (RHD*01N.72): RH1 (ISBT classification)
  • RHD*D-CE(3-5)-D (DVI type 4): RH
  • RHD*D-CE(3-6)-D (DVI type 3): RH
  • RHD*D-cE(4-5)-D (DVI type 1): RH
  • RHD*D-CE(4-6)-D (DVI type 2): RH
  • RHD*D-CE(4-7)-D (RHD*01N.07): RH
  • RHD*D-CE(4-7)-D (RHD*01N.07): RH1 (ISBT classification)
  • RHD*D-CE(4-9)-D (DEL44): RH1 (ISBT classification)
  • RHD*D-CE(5-6)-D (DV type 10): RH1 (ISBT classification)
  • RHD*D-cE(5-7)-D (DBU, RHD*41, DEL23): RH1 (ISBT classification)
  • RHD*D-CEVS(4-7)-D (RHD*01N.06): RH1 (ISBT classification)
  • RHD*D-CEVS(4-7)-D (RHD*01N.06): RH (weak)
  • RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01): RH1 (ISBT classification)
  • RHD*DIIIa-CEVS(4-7)-D (RHD*03N.01): RH
  • RHD*Dpsi (RHD*08N.01): RH1 (ISBT classification)
  • RHD*Ex1del (RHD*01N.67): RH1 (ISBT classification)
  • RHD*Ex8del (DEL30): RH1 (ISBT classification)
  • standard RHD (RHD*01): RH1 (ISBT classification)