Article
The RHD(1227G>A) DEL-associated allele is the most prevalent DEL allele in Australian D- blood donors with C+ and/or E+ phenotypes. Scott SA, Nagl L, Tilley L, Liew YW, Condon J, Flower R, Hyland CA. Transfusion, 2014. [Citation]
Annotations by Allele
- apparently standard RHD with unexpected serology: RH1 (adsorption-elution was performed)
- apparently standard RHD with unexpected serology: otherHaplotype
- apparently standard RHD with unexpected serology: Prevalence
- RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated: RH1 (adsorption-elution was performed)
- RHD or DIIIa-CEVS(4-7)-D - partly characterized or subtypes not separated: Prevalence
- RHD*1153+1A (IVS8+1A, RHD*01N.26): RH1 (adsorption-elution was performed)
- RHD*1153+1A (IVS8+1A, RHD*01N.26): Prevalence
- RHD*1177C (weak D type 10): RH1 (adsorption-elution was performed)
- RHD*1177C (weak D type 10): otherHaplotype
- RHD*1177C (weak D type 10): Prevalence
- RHD*1227A (DEL1): RH1 (adsorption-elution was performed; 2 samples negative, 14 DEL)
- RHD*1227A (DEL1): RH1 (adsorption-elution was performed; 2 samples negative, 14 DEL)
- RHD*1227A (DEL1): otherHaplotype
- RHD*1227A (DEL1): otherHaplotype
- RHD*1227A (DEL1): otherHaplotype
- RHD*1227A (DEL1): otherHaplotype
- RHD*1227A (DEL1): Prevalence
- RHD*148+1A (IVS1+1A, DEL5): otherHaplotype
- RHD*148+1A (IVS1+1A, DEL5): Prevalence
- RHD*148+1A (IVS1+1A, DEL5): RH1 (adsorption-elution was performed)
- RHD*148+1A (IVS1+1A, DEL5): Serology (Table 4)
- RHD*148+5C (IVS1+5C, DEL21): RH1 (adsorption-elution was performed)
- RHD*148+5C (IVS1+5C, DEL21): otherHaplotype
- RHD*148+5C (IVS1+5C, DEL21): Prevalence
- RHD*297_319delCCAGTTCCCTTCTGGGAAGGTGG (RHD*01N.37): RH1 (adsorption-elution was performed)
- RHD*297_319delCCAGTTCCCTTCTGGGAAGGTGG (RHD*01N.37): otherHaplotype
- RHD*297_319delCCAGTTCCCTTCTGGGAAGGTGG (RHD*01N.37): Prevalence
- RHD*336-1A (IVS2-1A, RHD*01N.25): RH1 (adsorption-elution was performed)
- RHD*336-1A (IVS2-1A, RHD*01N.25): Prevalence
- RHD*336-2delA (IVS2-2delA, DEL22, RHD*53): Prevalence
- RHD*336-2delA (IVS2-2delA, DEL22, RHD*53): RH1 (adsorption-elution was performed)
- RHD*336-2delA (IVS2-2delA, DEL22, RHD*53): Serology (Table 4)
- RHD*336-2delA (IVS2-2delA, DEL22, RHD*53): otherHaplotype
- RHD*343delC (RHD*01N.23): RH1 (adsorption-elution was performed)
- RHD*343delC (RHD*01N.23): Prevalence
- RHD*361_371delTTGTCGGTGCT or RHD*356_366delGTGCTTTGTCG (RHD*01N.41): RH1 (adsorption-elution was performed)
- RHD*361_371delTTGTCGGTGCT or RHD*356_366delGTGCTTTGTCG (RHD*01N.41): Prevalence
- RHD*443G (RHD*01N.73): RH1 (adsorption-elution was performed)
- RHD*443G (RHD*01N.73): Prevalence
- RHD*486+1A (IVS3+1A, DEL8): Prevalence
- RHD*486+1A (IVS3+1A, DEL8): RH1 (adsorption-elution was performed; 5 samples negative, 1 DEL)
- RHD*486+1A (IVS3+1A, DEL8): RH1 (adsorption-elution was performed; 5 samples negative, 1 DEL)
- RHD*486+1A (IVS3+1A, DEL8): otherHaplotype
- RHD*486+1A (IVS3+1A, DEL8): otherHaplotype
- RHD*486+2A (IVS3+2A, DEL9): Prevalence
- RHD*486+2A (IVS3+2A, DEL9): RH1 (adsorption-elution was performed; negative for 3 samples, positive for 1)
- RHD*486+2A (IVS3+2A, DEL9): RH1 (adsorption-elution was performed; negative for 3 samples, positive for 1)
- RHD*486+2A (IVS3+2A, DEL9): otherHaplotype
- RHD*486+2A (IVS3+2A, DEL9): otherHaplotype
- RHD*487_490delACAG or RHD*489_492delAGAC (RHD*01N.13): Prevalence
- RHD*487_490delACAG or RHD*489_492delAGAC (RHD*01N.13): RH1 (adsorption-elution was performed)
- RHD*885T (weak partial D type 11): RH1 (adsorption-elution was performed; 1 sample negative, 9 DEL)
- RHD*885T (weak partial D type 11): RH1 (adsorption-elution was performed; 1 sample negative, 9 DEL)
- RHD*885T (weak partial D type 11): otherHaplotype
- RHD*885T (weak partial D type 11): otherHaplotype
- RHD*885T (weak partial D type 11): Prevalence
- RHD*939+2A (IVS6+2A, RHD*01N.38): RH1 (adsorption-elution was performed)
- RHD*939+2A (IVS6+2A, RHD*01N.38): otherHaplotype
- RHD*939+2A (IVS6+2A, RHD*01N.38): Prevalence
- RHD*93insT (RHD*01N.50, DEL18): otherHaplotype
- RHD*93insT (RHD*01N.50, DEL18): Prevalence
- RHD*93insT (RHD*01N.50, DEL18): RH1 (adsorption-elution was performed)
- RHD*CE(1-3)-D (RHD*01N.43): RH1 (adsorption-elution was performed)
- RHD*CE(1-3)-D (RHD*01N.43): Prevalence
- RHD*D-CE(2-7)-D (RHD*01N.05): RH1 (adsorption-elution was performed)
- RHD*D-CE(2-7)-D (RHD*01N.05): Prevalence
- RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04): Prevalence
- RHD*D-CE(2-9)-D (RHD*01N.03, RHD*01N.04): RH1 (adsorption-elution was performed)
- RHD*D-CE(3-8/9)-D - partly characterized: RH1 (adsorption-elution was performed)
- RHD*D-CE(3-8/9)-D - partly characterized: Prevalence
- RHD*D-CE(4-7)-D (RHD*01N.07): Prevalence
- RHD*D-CE(4-7)-D (RHD*01N.07): RH1 (adsorption-elution was performed)
- RHD*D-CE(4-9)-D (DEL44): RH1 (adsorption-elution was performed)
- RHD*D-CE(4-9)-D (DEL44): Prevalence
- RHD*Ex8del (DEL30): Prevalence
- RHD*Ex8del (DEL30): RH1 (adsorption-elution was performed)
- RHD*Ex8del (DEL30): otherHaplotype
- RHD*Ex9del: RH1 (same sample as
29214630 ; adsorption-elution was performed) - RHD*Ex9del: otherHaplotype
- RHD*Ex9del: Prevalence
- RHD*Ex9del: Serology (Table 4)